Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag

Cat: VG40263-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DENV-NS1 Reagents
CRO Services
Product recommended

All DENV-NS1 Reagents
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
DENV
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of DENV-2 (strain New Guinea C) NS1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI (6kb + 1.11kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DENV-NS1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag Alternative Names
DENV-NS1 cDNA ORF Clone, DENV
DENV-NS1 Background Information

DENV-NS1 cDNA ORF Clone, DENV, Related Products

Product Name Catalog#(PDF)
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 Gene cDNA clone plasmid VG40529-G
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 Gene cDNA clone plasmid VG40527-G
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid (Codon Optimized) VG40263-G
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 Gene cDNA clone plasmid VG40528-G
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 natural ORF mammalian expression plasmid VG40529-UT
Dengue virus DENV-2 (strain New Guinea C) NS1 natural ORF mammalian expression plasmid VG40263-UT
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 natural ORF mammalian expression plasmid VG40528-UT
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 natural ORF mammalian expression plasmid VG40527-UT
Dengue virus DENV-2 (strain New Guinea C) NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40263-ACGLN
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40528-ACGLN
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-GFPSpark tag VG40528-ACG
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40529-ACGLN
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-GFPSpark tag VG40527-ACG
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40527-ACGLN
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-GFPSpark tag VG40529-ACG
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-GFPSpark tag VG40263-ACG
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-GFPSpark tag VG40528-ANG
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-GFPSpark tag VG40529-ANG
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-GFPSpark tag VG40263-ANG
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-GFPSpark tag VG40527-ANG
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40528-ACR
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40529-ACR
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40263-ACR
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40527-ACR
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40263-ANR
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40528-ANR
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40529-ANR
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40527-ANR
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Flag tag VG40263-CF
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-Flag tag VG40528-CF
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-Flag tag VG40527-CF
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-Flag tag VG40529-CF
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-Flag tag VG40527-NF
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Flag tag VG40263-NF
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-Flag tag VG40528-NF
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-Flag tag VG40529-NF
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-His tag VG40528-CH
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-His tag VG40529-CH
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-His tag VG40263-CH
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-His tag VG40527-CH
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-His tag VG40529-NH
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-His tag VG40528-NH
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-His tag VG40527-NH
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-HA tag VG40528-CY
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-HA tag VG40527-CY
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA tag VG40263-CY
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-HA tag VG40529-CY
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-HA tag VG40528-NY
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-HA tag VG40263-NY
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-HA tag VG40527-NY
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-HA tag VG40529-NY
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, C-Myc tag VG40527-CM
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Myc tag VG40263-CM
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, C-Myc tag VG40529-CM
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, C-Myc tag VG40528-CM
Dengue virus 4 (DENV-4) (strain Philippines/H241/1956) DENV-NS1 ORF mammalian expression plasmid, N-Myc tag VG40529-NM
Dengue virus 3 (DENV-3) (strain Philippines/H87/1956) DENV-NS1 ORF mammalian expression plasmid, N-Myc tag VG40528-NM
Dengue virus 1 (DENV-1) (strain US/Hawaii/1944) DENV-NS1 ORF mammalian expression plasmid, N-Myc tag VG40527-NM
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc tag VG40263-NM
info info
添加购物车成功! 添加购物车失败!