Quick Order

Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
DENV DENV-C cDNA Clone Product Information
NCBI RefSeq:AF038403.1
RefSeq ORF Size:342bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) anchored capsid protein (C) with N terminal His tag.
Gene Synonym:DENV-C
Species:DENV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence AF038403.1 (97..438), corresponding to amino acid sequence AAC59275.1 (aa 1-114).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-His tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-GFPSpark tagVG40262-ACG$325
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40262-ACR$325
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-GFPSpark tagVG40262-ANG$325
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40262-ANR$325
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-Flag tagVG40262-CF$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-His tagVG40262-CH$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-Myc tagVG40262-CM$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, C-HA tagVG40262-CY$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid (Codon Optimized)VG40262-G$95
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-Flag tagVG40262-NF$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-His tagVG40262-NH$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-Myc tagVG40262-NM$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) ORF mammalian expression plasmid, N-HA tagVG40262-NY$295
Dengue virus DENV-2 (strain New Guinea C) anchored capsid protein (C) natural ORF mammalian expression plasmidVG40262-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40262-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"