Quick Order

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
DENV DENV-NS5A cDNA Clone Product Information
NCBI RefSeq:AF038403.1
RefSeq ORF Size:2700bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS5A with C terminal HA tag.
Gene Synonym:DENV-NS5A
Species:DENV
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence AF038403.1 (7570..10269), corresponding to amino acid sequence AAC59275.1 (aa 2492-3391).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-GFPSpark tagVG40267-ACG$425
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40267-ACR$425
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-GFPSpark tagVG40267-ANG$425
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40267-ANR$425
Dengue virus DENV-2 (strain New Guinea C) NS5A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40267-CF$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-His tagVG40267-CH$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-Myc tagVG40267-CM$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, C-HA tagVG40267-CY$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid (Codon Optimized)VG40267-G$145
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Flag tagVG40267-NF$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-His tagVG40267-NH$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-Myc tagVG40267-NM$395
Dengue virus DENV-2 (strain New Guinea C) NS5A ORF mammalian expression plasmid, N-HA tagVG40267-NY$395
Dengue virus DENV-2 (strain New Guinea C) NS5A natural ORF mammalian expression plasmidVG40267-UT$395
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40267-CY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"