Quick Order

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
DENV DENV-NS1 cDNA Clone Product Information
NCBI RefSeq:AF038403.1
RefSeq ORF Size:1056bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS1 with N terminal His tag.
Gene Synonym:DENV-NS1
Species:DENV
Vector:pCMV3-N-His
Plasmid:pCMV3-His-DENV2-AF038403-NS1
Restriction Site:KpnI + XbaI (6kb + 1.11kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
DENV DENV-NS1 Gene Plasmid Map
Dengue virus DENV-2 (strain New Guinea C) NS1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-GFPSpark tagVG40263-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40263-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-GFPSpark tagVG40263-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40263-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Flag tagVG40263-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-His tagVG40263-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-Myc tagVG40263-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, C-HA tagVG40263-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid (Codon Optimized)VG40263-G$95
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Flag tagVG40263-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-His tagVG40263-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-Myc tagVG40263-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS1 ORF mammalian expression plasmid, N-HA tagVG40263-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS1 natural ORF mammalian expression plasmidVG40263-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40263-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Dengue virus DENV-2 (strain New Guinea C) NS1  natural ORF mammalian expression plasmid, N-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"