After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CLEC7A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CLEC7A Gene Plasmid Map
Human Dectin-1 / CLEC7A transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

  • Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.
  • Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.
  • Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.
  • Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.
  • Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.
  • Contact Us
    • Human Dectin-1 / CLEC7A transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.