Quick Order

Human Decorin/DCN transcript variant A1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human Decorin cDNA Clone Product Information
NCBI RefSeq:NM_001920.3
RefSeq ORF Size:1080bp
cDNA Description:Full length Clone DNA of Homo sapiens decorin, transcript variant A1 with HA tag.
Gene Synonym:DCN, CSCD, PG40, PGII, PGS2, DSPG2, SLRR1B
Restriction Site:KpnI + XhoI (5.5kb + 1.11kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Decorin Gene Plasmid Map
Human DCN / Decorin transcript variant A1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan protein. It belongs to the small leucine-rich proteoglycan (SLRP) family and consists of a core protein and a covalently linked glycosaminoglycan chain which is either chondroitin sulfate (CS) or dermatan sulfate (DS). As a component of connective tissue, decorin interacts with several extracellular matrix components, such as type I collagen and fibronectin, and plays a role in matrix assembly. Decorin resides in the tumor microenvironment and affects the biology of various types of cancer by downregulating the activity of several receptors involved in cell growth and survival. Decorin binds to and modulates the signaling of the epidermal growth factor receptor and other members of the ErbB family of receptor tyrosine kinases. It exerts its antitumor activity by a dual mechanism: via inhibition of these key receptors through their physical downregulation coupled with attenuation of their signaling, and by binding to and sequestering TGFbeta. Decorin also modulates the insulin-like growth factor receptor and the low-density lipoprotein receptor-related protein 1, which indirectly affects the TGFbeta receptor pathway. Decorin plays significant roles in tissue development and assembly, as well as playing both direct and indirect signaling roles.

  • Mogyorsi A, et al. (1999) What is the role of decorin in diabetic kidney disease? Nephrol Dial Transplant. 14(5): 1078-81.
  • Reed CC, et al. (2002) The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj J. 19(4-5): 249-55.
  • Goldoni S, et al. (2008) Tumor microenvironment: Modulation by decorin and related molecules harboring leucine-rich tandem motifs. Int J Cancer. 123(11): 2473-9.
  • Size / Price
    Catalog: HG10189-M-Y
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human DCN / Decorin transcript variant A1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.