DcR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10224-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DcR3 Reagents
CRO Services

All DcR3 Reagents
DcR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
903 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 255 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 6b, decoy, transcript variant M68E DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XbaI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DcR3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DcR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human DcR3/TNFRSF6B Gene Expression validated Image 2394
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human CREB1 Gene Plasmid Map 7174
DcR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DCR3 cDNA ORF Clone, Human;DJ583P15.1.1 cDNA ORF Clone, Human;M68 cDNA ORF Clone, Human;M68E cDNA ORF Clone, Human;TNFRSF6B cDNA ORF Clone, Human;TR6 cDNA ORF Clone, Human
DcR3 Background Information

Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) also known as DcR3(Decoy Receptor 3) and M68 is the tumor necrosis factor receptor superfamily. DcR3/TNFRSF6B belongs to the tumor necrosis factor receptor superfamily. The encoded protein is postulated to play a regulatory role in suppressing FasL- and LIGHT-mediated cell death. It acts as a decoy receptor that competes with death receptors for ligand binding. Over-expression of this gene has been noted in gastrointestinal tract tumors. Read-through transcription into this gene from the neighboring upstream gene, which encodes regulator of telomere elongation helicase 1 (RTEL1), generates a non-coding transcript. DcR3/TNFRSF6B is detected in fetal lung, brain and liver. DcR3/TNFRSF6B is also detected in adult stomach, spinal cord, lymph node, trachea, spleen, colon and lung. This protein is highly expressed in several primary tumors from colon, stomach, rectum, esophagus and in SW480 colon carcinoma cells.

Full Name
tumor necrosis factor receptor superfamily member 6b
References
  • Migone TS, et al. (2002) TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity. 16(3): 479-92.
  • Takahama Y, et al. (2002) The prognostic significance of overexpression of the decoy receptor for Fas ligand (DcR3) in patients with gastric carcinomas. Gastric Cancer. 5(2): 61-8.
  • Zhang J, et al. (2001) Modulation of T-cell responses to alloantigens by TR6/DcR3. J Clin Invest. 107(11): 1459-68.
  • info info
    添加购物车成功! 添加购物车失败!