Quick Order

Danio rerio (zebrafish) EFNB2A / Ephrin B2a Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Danio rerio (zebrafish) EFNB2A cDNA Clone Product Information
NCBI RefSeq:AF375225.1
RefSeq ORF Size:999bp
cDNA Description:Full length Clone DNA of Danio rerio (zebrafish) ephrin B2a with N terminal His tag.
Gene Synonym:efnb2, ephrin-B2a, id:ibd5072, efnb2a
Species:Danio rerio (zebrafish)
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Efnb2a, also known as ephrin B2a, belongs to the ephrin family. Members of this family are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. Efnb2a binds promiscuously Eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Efnb2a, together with ephb4 may play a central role in heart morphogenesis and angiogenesis through regulation of cell adhesion and cell migration.

References
  • Shaw KM. et al., 2006, Dev Dyn. 235 (7): 1753-60.
  • Kemp HA. et al., 2009, Dev Biol. 327 (2): 313-26.
  • Patten SA. et al., 2012, PLoS One. 7 (2): e31650.
  • Size / Price
    Catalog: ZG63002-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"