After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Decorin/DCN transcript variant A1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human Decorin cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human Decorin Gene Plasmid Map
Human DCN / Decorin transcript variant A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Decorin is a ubiquitous small cellular or pericellular matrix proteoglycan and is closely related in structure to biglycan protein. It belongs to the small leucine-rich proteoglycan (SLRP) family and consists of a core protein and a covalently linked glycosaminoglycan chain which is either chondroitin sulfate (CS) or dermatan sulfate (DS). As a component of connective tissue, decorin interacts with several extracellular matrix components, such as type I collagen and fibronectin, and plays a role in matrix assembly. Decorin resides in the tumor microenvironment and affects the biology of various types of cancer by downregulating the activity of several receptors involved in cell growth and survival. Decorin binds to and modulates the signaling of the epidermal growth factor receptor and other members of the ErbB family of receptor tyrosine kinases. It exerts its antitumor activity by a dual mechanism: via inhibition of these key receptors through their physical downregulation coupled with attenuation of their signaling, and by binding to and sequestering TGFbeta. Decorin also modulates the insulin-like growth factor receptor and the low-density lipoprotein receptor-related protein 1, which indirectly affects the TGFbeta receptor pathway. Decorin plays significant roles in tissue development and assembly, as well as playing both direct and indirect signaling roles.

References
  • Mogyorsi A, et al. (1999) What is the role of decorin in diabetic kidney disease? Nephrol Dial Transplant. 14(5): 1078-81.
  • Reed CC, et al. (2002) The role of decorin in collagen fibrillogenesis and skin homeostasis. Glycoconj J. 19(4-5): 249-55.
  • Goldoni S, et al. (2008) Tumor microenvironment: Modulation by decorin and related molecules harboring leucine-rich tandem motifs. Int J Cancer. 123(11): 2473-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"