NBL1 cDNA ORF Clone, Human, untagged

Cat: HG10169-M-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NBL1 Reagents
CRO Services

All NBL1 Reagents
NBL1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
543 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human neuroblastoma, suppression of tumorigenicity 1 (NBL1), transcript variant 2 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NBL1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NBL1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
NBL1 cDNA ORF Clone, Human, untagged Alternative Names
D1S1733E cDNA ORF Clone, Human;DAN cDNA ORF Clone, Human;DAND1 cDNA ORF Clone, Human;NB cDNA ORF Clone, Human;NO3 cDNA ORF Clone, Human
NBL1 Background Information

The Dan (Differential screening-selected gene aberrative in neuroblastoma, also known as N03) gene was first identified as the putative rat tumor suppressor gene and encodes a protein structurally related to Cerberus and Gremlin in vertebrates. It is a founding member of the DAN family of secreted proteins, acts as an inhibitor of cell cycle progression and is closely involved in retinoic acid-induced neuroblastoma differentiation. There are at least five mammalian protein members in the evolutionarily conserved Dan family including DAN, Gremlin/DRM, Cer1 (Cerberus-related), Dante and PRDC (protein related to DAN and cereberus), and share the C-terminal cystine-knot motif. As a secreted glycoprotein, DAN is a member of a class of glycoproteins shown to be secreted inhibitors of the transforming growth factor-beta (TGF-beta) and bone morphogenic protein pathways. It binds to BMPs and preventing their interactions with signaling receptor complexes, and accordingly regulates the processes of embryonic development and tissue differentiation. DAN gene product may have an important role in regulation of the entry of cells into the S phase. In addition, DAN gene product possesses an ability to revert phenotypes of transformed rat fibroblasts and represents a candidate tumour suppressor gene for neuroblastoma.

Full Name
neuroblastoma 1, DAN family BMP antagonist
References
  • Ozaki T, et al. (1995) Overexpression of DAN gene product in normal rat fibroblasts causes a retardation of the entry into the S phase. Cancer Res. 55(4): 895-900.
  • Nakamura Y, et al. (1997) A product of DAN, a novel candidate tumour suppressor gene, is secreted into culture medium and suppresses DNA synthesis. Eur J Cancer. 33(12): 1986-90.
  • Ogita J, et al. (2001) Expression of the Dan gene during chicken embryonic development. Mech Dev. 109(2): 363-5.
  • Kim AS, et al. (2003) Expression of the BMP antagonist Dan during murine forebrain development. Brain Res Dev Brain Res. 145(1): 159-62.
  • info info
    添加购物车成功! 添加购物车失败!