YWHAZ cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90492-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All YWHAZ Reagents
CRO Services
Product recommended

All YWHAZ Reagents
YWHAZ cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Rhesus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

YWHAZ Background Information
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta

YWHAZ cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
YWHAZ cDNA ORF Clone in Cloning Vector, Rhesus CG90492-G
YWHAZ cDNA ORF Clone, Rhesus, untagged CG90492-UT
YWHAZ cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90492-ACG
YWHAZ Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90492-ACGLN
YWHAZ cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90492-ANG
YWHAZ cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90492-ACR
YWHAZ cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90492-ANR
YWHAZ cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90492-CF
YWHAZ cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90492-NF
YWHAZ cDNA ORF Clone, Rhesus, N-His tag CG90492-NH
YWHAZ cDNA ORF Clone, Rhesus, C-HA tag CG90492-CY
YWHAZ cDNA ORF Clone, Rhesus, N-HA tag CG90492-NY
YWHAZ cDNA ORF Clone, Rhesus, C-Myc tag CG90492-CM
YWHAZ cDNA ORF Clone, Rhesus, N-Myc tag CG90492-NM

YWHAZ cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
YWHAZ cDNA ORF Clone in Cloning Vector, Rat RG81045-U
YWHAZ cDNA ORF Clone, Rat, untagged RG81045-UT
YWHAZ cDNA ORF Clone, Rat, C-GFPSpark® tag RG81045-ACG
YWHAZ Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81045-ACGLN
YWHAZ cDNA ORF Clone, Rat, N-GFPSpark® tag RG81045-ANG
YWHAZ cDNA ORF Clone, Rat, C-OFPSpark® tag RG81045-ACR
YWHAZ cDNA ORF Clone, Rat, N-OFPSpark® tag RG81045-ANR
YWHAZ cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81045-CF
YWHAZ cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81045-NF
YWHAZ cDNA ORF Clone, Rat, C-His tag RG81045-CH
YWHAZ cDNA ORF Clone, Rat, N-His tag RG81045-NH
YWHAZ cDNA ORF Clone, Rat, C-HA tag RG81045-CY
YWHAZ cDNA ORF Clone, Rat, N-HA tag RG81045-NY
YWHAZ cDNA ORF Clone, Rat, C-Myc tag RG81045-CM
YWHAZ cDNA ORF Clone, Rat, N-Myc tag RG81045-NM
YWHAZ qPCR Primer Pairs, Rat RP301009

YWHAZ cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
YWHAZ cDNA ORF Clone in Cloning Vector, Mouse MG58318-U
YWHAZ cDNA ORF Clone, Mouse, untagged MG58318-UT
YWHAZ cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58318-ACG
YWHAZ Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58318-ACGLN
YWHAZ cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58318-ANG
YWHAZ cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58318-ACR
YWHAZ cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58318-ANR
YWHAZ cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58318-CF
YWHAZ cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58318-NF
YWHAZ cDNA ORF Clone, Mouse, C-His tag MG58318-CH
YWHAZ cDNA ORF Clone, Mouse, N-His tag MG58318-NH
YWHAZ cDNA ORF Clone, Mouse, C-HA tag MG58318-CY
YWHAZ cDNA ORF Clone, Mouse, N-HA tag MG58318-NY
YWHAZ cDNA ORF Clone, Mouse, C-Myc tag MG58318-CM
YWHAZ cDNA ORF Clone, Mouse, N-Myc tag MG58318-NM

YWHAZ cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
YWHAZ cDNA ORF Clone in Cloning Vector, Human HG16417-G
YWHAZ cDNA ORF Clone, Human, untagged HG16417-UT
YWHAZ cDNA ORF Clone, Human, C-GFPSpark® tag HG16417-ACG
YWHAZ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16417-ACGLN
YWHAZ cDNA ORF Clone, Human, N-GFPSpark® tag HG16417-ANG
YWHAZ cDNA ORF Clone, Human, C-OFPSpark® tag HG16417-ACR
YWHAZ cDNA ORF Clone, Human, N-OFPSpark® tag HG16417-ANR
YWHAZ cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16417-CF
YWHAZ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16417-NF
YWHAZ cDNA ORF Clone, Human, C-His tag HG16417-CH
YWHAZ cDNA ORF Clone, Human, N-His tag HG16417-NH
YWHAZ cDNA ORF Clone, Human, C-HA tag HG16417-CY
YWHAZ cDNA ORF Clone, Human, N-HA tag HG16417-NY
YWHAZ cDNA ORF Clone, Human, C-Myc tag HG16417-CM
YWHAZ cDNA ORF Clone, Human, N-Myc tag HG16417-NM
YWHAZ qPCR Primer Pairs, Human HP105166
info info
添加购物车成功! 添加购物车失败!