VILIP1 cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90557-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VILIP1 Reagents
CRO Services
Product recommended

All VILIP1 Reagents
VILIP1 cDNA ORF Clone, Cynomolgus, N-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Cynomolgus visinin-like 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VILIP1 Background Information

VILIP-1, also known as VSNL1, is strongly expressed in granule cells of the cerebellum where it associates with membranes in a calcium-dependent manner and modulates intracellular signaling pathways of the central nervous system by directly or indirectly regulating the activity of adenylyl cyclase. VILIP-1 gene is a member of the visinin/recoverin subfamily of neuronal calcium sensor proteins. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined.

Full Name
visinin-like 1
References
  • Burgoyne RD. 2007, Nat Rev Neurosci. 8 (3): 182-93.
  • Kose A. et al., 1990, Brain Res. 518 (1-2): 209-17.
  • Polymeropoulos MH. et al., 1996, Genomics. 29 (1): 273-5.
  • VILIP1 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    VILIP1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90557-G
    VILIP1 cDNA ORF Clone, Cynomolgus, untagged CG90557-UT
    VILIP1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90557-ACG
    VILIP1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90557-ACGLN
    VILIP1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90557-ANG
    VILIP1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90557-ACR
    VILIP1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90557-ANR
    VILIP1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90557-CF
    VILIP1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90557-NF
    VILIP1 cDNA ORF Clone, Cynomolgus, C-His tag CG90557-CH
    VILIP1 cDNA ORF Clone, Cynomolgus, N-His tag CG90557-NH
    VILIP1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90557-CY
    VILIP1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90557-CM
    VILIP1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90557-NM

    VILIP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VILIP1 cDNA ORF Clone in Cloning Vector, Mouse MG52838-G
    VILIP1 cDNA ORF Clone, Mouse, untagged MG52838-UT
    VILIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52838-ACG
    VILIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52838-ACGLN
    VILIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52838-ANG
    VILIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52838-ACR
    VILIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52838-ANR
    VILIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52838-CF
    VILIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52838-NF
    VILIP1 cDNA ORF Clone, Mouse, C-His tag MG52838-CH
    VILIP1 cDNA ORF Clone, Mouse, N-His tag MG52838-NH
    VILIP1 cDNA ORF Clone, Mouse, C-HA tag MG52838-CY
    VILIP1 cDNA ORF Clone, Mouse, N-HA tag MG52838-NY
    VILIP1 cDNA ORF Clone, Mouse, C-Myc tag MG52838-CM
    VILIP1 cDNA ORF Clone, Mouse, N-Myc tag MG52838-NM

    VILIP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VILIP1 cDNA ORF Clone in Cloning Vector, Human HG14571-U
    VILIP1 cDNA ORF Clone, Human, untagged HG14571-UT
    VILIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14571-ACGLN
    VILIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14571-ACG
    VILIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14571-ANG
    VILIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14571-ACR
    VILIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14571-ANR
    VILIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14571-CF
    VILIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14571-NF
    VILIP1 cDNA ORF Clone, Human, C-His tag HG14571-CH
    VILIP1 cDNA ORF Clone, Human, N-His tag HG14571-NH
    VILIP1 cDNA ORF Clone, Human, C-HA tag HG14571-CY
    VILIP1 cDNA ORF Clone, Human, N-HA tag HG14571-NY
    VILIP1 cDNA ORF Clone, Human, C-Myc tag HG14571-CM
    VILIP1 cDNA ORF Clone, Human, N-Myc tag HG14571-NM
    info info
    添加购物车成功! 添加购物车失败!