UBE2V2 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90712-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBE2V2 Reagents
CRO Services
Product recommended

All UBE2V2 Reagents
UBE2V2 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Rhesus ubiquitin-conjugating enzyme E2 variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2V2 Background Information
Full Name
ubiquitin-conjugating enzyme E2 variant 2

UBE2V2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
UBE2V2 cDNA ORF Clone in Cloning Vector, Rhesus CG90712-G
UBE2V2 cDNA ORF Clone, Rhesus, untagged CG90712-UT
UBE2V2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90712-ACGLN
UBE2V2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90712-ACG
UBE2V2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90712-ANG
UBE2V2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90712-ACR
UBE2V2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90712-ANR
UBE2V2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90712-CF
UBE2V2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90712-NF
UBE2V2 cDNA ORF Clone, Rhesus, C-His tag CG90712-CH
UBE2V2 cDNA ORF Clone, Rhesus, N-His tag CG90712-NH
UBE2V2 cDNA ORF Clone, Rhesus, C-HA tag CG90712-CY
UBE2V2 cDNA ORF Clone, Rhesus, N-HA tag CG90712-NY
UBE2V2 cDNA ORF Clone, Rhesus, C-Myc tag CG90712-CM

UBE2V2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBE2V2 cDNA ORF Clone in Cloning Vector, Rat RG81306-U
UBE2V2 cDNA ORF Clone, Rat, untagged RG81306-UT
UBE2V2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81306-ACG
UBE2V2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81306-ACGLN
UBE2V2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81306-ANG
UBE2V2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81306-ACR
UBE2V2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81306-ANR
UBE2V2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81306-CF
UBE2V2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81306-NF
UBE2V2 cDNA ORF Clone, Rat, C-His tag RG81306-CH
UBE2V2 cDNA ORF Clone, Rat, N-His tag RG81306-NH
UBE2V2 cDNA ORF Clone, Rat, C-HA tag RG81306-CY
UBE2V2 cDNA ORF Clone, Rat, N-HA tag RG81306-NY
UBE2V2 cDNA ORF Clone, Rat, C-Myc tag RG81306-CM
UBE2V2 cDNA ORF Clone, Rat, N-Myc tag RG81306-NM
UBE2V2 qPCR Primer Pairs, Rat RP301262

UBE2V2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBE2V2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1211-U
UBE2V2 cDNA ORF Clone, Mouse, untagged MG5A1211-UT
UBE2V2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1211-ACGLN
UBE2V2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1211-ACG
UBE2V2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1211-ANG
UBE2V2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1211-ACR
UBE2V2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1211-ANR
UBE2V2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1211-CF
UBE2V2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1211-NF
UBE2V2 cDNA ORF Clone, Mouse, C-His tag MG5A1211-CH
UBE2V2 cDNA ORF Clone, Mouse, N-His tag MG5A1211-NH
UBE2V2 cDNA ORF Clone, Mouse, C-HA tag MG5A1211-CY
UBE2V2 cDNA ORF Clone, Mouse, N-HA tag MG5A1211-NY
UBE2V2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1211-CM
UBE2V2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1211-NM

UBE2V2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBE2V2 cDNA ORF Clone in Cloning Vector, Human HG12881-U
UBE2V2 cDNA ORF Clone, Human, untagged HG12881-UT
UBE2V2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12881-ACGLN
UBE2V2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12881-ACG
UBE2V2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12881-ANG
UBE2V2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12881-ACR
UBE2V2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12881-ANR
UBE2V2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12881-CF
UBE2V2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12881-NF
UBE2V2 cDNA ORF Clone, Human, C-His tag HG12881-CH
UBE2V2 cDNA ORF Clone, Human, N-His tag HG12881-NH
UBE2V2 cDNA ORF Clone, Human, C-HA tag HG12881-CY
UBE2V2 cDNA ORF Clone, Human, N-HA tag HG12881-NY
UBE2V2 cDNA ORF Clone, Human, C-Myc tag HG12881-CM
UBE2V2 cDNA ORF Clone, Human, N-Myc tag HG12881-NM
info info
添加购物车成功! 添加购物车失败!