Quick Order

Cynomolgus Thrombopoietin/THPO Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus THPO cDNA Clone Product Information
NCBI RefSeq:XM_005546569.1
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) thrombopoietin with N terminal His tag.
Gene Synonym:THO, THPO
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Thrombopoietin (TPO or THPO), also known as myeloproliferative leukemia virus ligand (c-Mpl), is a hematopoietic growth factor belonging to the EPO/TPO family. The thrombopoietin protein is produced mainly by the liver and the kidney that regulates the production of platelets by the bone marrow. Thrombopoietin protein stimulates both proliferation of progenitor megakaryocytes and their maturation to platelet-producing megakaryocytes, and also accelerates the recovery of platelets. Thrombopoietin protein is involved in cardiovascular disease as it regulates megakaryocyte development and enhances platelet adhesion/aggregation. It has been identified that surface c-MPL, the receptor for thrombopoietin protein, binds to the ligand and mediates the action.

References
  • Ryu T,et al.(2003) Thrombopoietin-producing hepatocellular carcinoma. Intern Med. 42(8): 730-4.
  • Higashihara M,et al. (2003) Thrombopoietin-producing tumor. Intern Med. 42(8): 632-3?
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"