p53 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90001-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All p53 Reagents
CRO Services
Product recommended

All p53 Reagents
p53 cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Cynomolgus tumor protein p53 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p53 cDNA ORF Clone, Cynomolgus, N-His tag Alternative Names
p53 cDNA ORF Clone, Cynomolgus;TP53 cDNA ORF Clone, Cynomolgus
p53 Background Information

p53, also known as Tp53, is a DNA-binding protein which belongs to the p53 family. It contains transcription activation, DNA-binding, and oligomerization domains. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 (TP53) is a transcription factor whose protein levels and post-translational modification state alter in response to cellular stress (such as DNA damage, hypoxia, spindle damage). Activation of p53 begins through a number of mechanisms including phosphorylation by ATM, ATR, Chk1 and MAPKs. MDM2 is a ubiquitn ligase that binds p53 and targets p53 for proteasomal degradation. Phosphorylation, p14ARF and USP7 prevent MDM2-p53 interactions, leading to an increase in stable p53 tetramers in the cytoplasm. Further modifications such as methylation and acetylation lead to an increase in Tp53 binding to gene specific response elements. Tp53 regulates a large number of genes (>100 genes) that control a number of key tumor suppressing functions such as cell cycle arrest, DNA repair, senescence and apoptosis. Whilst the activation of p53 often leads to apoptosis, p53 inactivation facilitates tumor progression. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mutants of p53 that frequently occur in a number of different human cancers fail to bind the consensus DNA binding site, and hence cause the loss of tumor suppressor activity. Defects in TP53 are a cause of esophageal cancer, Li-Fraumeni syndrome, lung cancer and adrenocortical carcinoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor protein p53
References
  • Bakhrat A, et al. (2010) Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis. Apoptosis. 15(12):1425-34.
  • Kurzhals RL, et al. (2011) Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet. 7(6):e1002103.
  • Pardi N, et al. (2011) In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62(4):397-412.
  • Wells BS, et al. (2012) Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53. Dev Biol. 361(2):263-76.
  • p53 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    p53 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90001-G
    p53 cDNA ORF Clone, Cynomolgus, untagged CG90001-UT
    p53 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90001-ACGLN
    p53 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90001-ACG
    p53 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90001-ANG
    p53 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90001-ACR
    p53 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90001-ANR
    p53 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90001-CF
    p53 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90001-NF
    p53 cDNA ORF Clone, Cynomolgus, C-His tag CG90001-CH
    p53 cDNA ORF Clone, Cynomolgus, C-HA tag CG90001-CY
    p53 cDNA ORF Clone, Cynomolgus, N-HA tag CG90001-NY
    p53 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90001-CM
    p53 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90001-NM

    p53 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    p53 cDNA ORF Clone in Cloning Vector, Mouse MG50534-M
    p53 cDNA ORF Clone, Mouse, untagged MG50534-UT
    p53 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50534-ACG
    p53 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50534-ACGLN
    p53 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50534-ANG
    p53 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50534-ACR
    p53 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50534-ANR
    p53 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50534-CF
    p53 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50534-NF
    p53 cDNA ORF Clone, Mouse, C-His tag MG50534-CH
    p53 cDNA ORF Clone, Mouse, N-His tag MG50534-NH
    p53 cDNA ORF Clone, Mouse, C-HA tag MG50534-CY
    p53 cDNA ORF Clone, Mouse, N-HA tag MG50534-NY
    p53 cDNA ORF Clone, Mouse, C-Myc tag MG50534-CM
    p53 cDNA ORF Clone, Mouse, N-Myc tag MG50534-NM
    p53 qPCR Primer Pairs, Mouse MP200526

    p53 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    p53 cDNA ORF Clone in Cloning Vector, Human HG10182-G
    p53 cDNA ORF Clone, Human, untagged HG10182-UT
    p53 cDNA ORF Clone, Human, C-GFPSpark® tag HG10182-ACG
    p53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10182-ACGLN
    p53 cDNA ORF Clone, Human, N-GFPSpark® tag HG10182-ANG
    p53 cDNA ORF Clone, Human, C-OFPSpark® tag HG10182-ACR
    p53 cDNA ORF Clone, Human, N-OFPSpark® tag HG10182-ANR
    p53 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10182-CF
    p53 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10182-NF
    p53 cDNA ORF Clone, Human, C-His tag HG10182-CH
    p53 cDNA ORF Clone, Human, N-His tag HG10182-NH
    p53 cDNA ORF Clone, Human, C-HA tag HG10182-CY
    p53 cDNA ORF Clone, Human, N-HA tag HG10182-NY
    p53 cDNA ORF Clone, Human, C-Myc tag HG10182-CM
    p53 cDNA ORF Clone, Human, N-Myc tag HG10182-NM
    p53 qPCR Primer Pairs, Human HP100250
    info info
    添加购物车成功! 添加购物车失败!