CD30L cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90091-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD30L Reagents
CRO Services
Product recommended

All CD30L Reagents
CD30L cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 8 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD30L Background Information

CD30 ligand (CD30L), also known as CD153 and TNFSF8, is a membrane-associated glycoprotein belonging to the TNF superfamily and TNFR superfamily, and is a specific ligand for CD30/TNFRSF8 originally described as a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. CD30L is a type-II membrane glycoprotein expressed on activated T cells, stimulated monocyte-macrophages, granulocytes, eosinophils, and some Burkitt-like lymphoma cell lines. CD30L is capable of transducing signals through CD30 on different CD30+ lymphoma cell lines, and mediates pleiotropic biologic effects including cell proliferation, activation, differentiation, as well as cell death by apoptosis. CD30-CD30 ligand interaction has been suggested to have a pathophysiologic role in malignant lymphomas, particularly Hodgkin disease, large cell anaplastic lymphomas and Burkitt lymphomas, and is also involved in activation and functioning of the T cell-dependent immune response. Thus, CD153 and its receptor CD30 are regarded as therapeutic targets in hematologic malignancies, autoimmune and inflammatory diseases.

Full Name
tumor necrosis factor (ligand) superfamily, member 8
Research Areas
References
  • Hargreaves PG, et al. (2002) Soluble CD30 binds to CD153 with high affinity and blocks transmembrane signaling by CD30. Eur J Immunol. 32(1): 163-73.
  • Blazar BR, et al. (2004) CD30/CD30 ligand (CD153) interaction regulates CD4+ T cell-mediated graft-versus-host disease. J Immunol. 173(5): 2933-41.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Adv Exp Med Biol. 647: 174-85.
  • CD30L cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD30L cDNA ORF Clone in Cloning Vector, Rhesus CG90091-G
    CD30L cDNA ORF Clone, Rhesus, untagged CG90091-UT
    CD30L Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90091-ACGLN
    CD30L cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90091-ACG
    CD30L cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90091-ACR
    CD30L cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90091-CF
    CD30L cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90091-NF
    CD30L cDNA ORF Clone, Rhesus, C-His tag CG90091-CH
    CD30L cDNA ORF Clone, Rhesus, N-His tag CG90091-NH
    CD30L cDNA ORF Clone, Rhesus, C-HA tag CG90091-CY
    CD30L cDNA ORF Clone, Rhesus, N-HA tag CG90091-NY
    CD30L cDNA ORF Clone, Rhesus, N-Myc tag CG90091-NM

    CD30L cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD30L cDNA ORF Clone in Cloning Vector, Rat RG80148-G
    CD30L cDNA ORF Clone, Rat, untagged RG80148-UT
    CD30L cDNA ORF Clone, Rat, C-GFPSpark® tag RG80148-ACG
    CD30L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80148-ACGLN
    CD30L cDNA ORF Clone, Rat, C-OFPSpark® tag RG80148-ACR
    CD30L cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80148-CF
    CD30L cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80148-NF
    CD30L cDNA ORF Clone, Rat, C-His tag RG80148-CH
    CD30L cDNA ORF Clone, Rat, N-His tag RG80148-NH
    CD30L cDNA ORF Clone, Rat, C-HA tag RG80148-CY
    CD30L cDNA ORF Clone, Rat, N-HA tag RG80148-NY
    CD30L cDNA ORF Clone, Rat, C-Myc tag RG80148-CM
    CD30L cDNA ORF Clone, Rat, N-Myc tag RG80148-NM
    CD30L qPCR Primer Pairs, Rat RP300143

    CD30L cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD30L cDNA ORF Clone, Mouse, untagged MG59275-UT
    CD30L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59275-ACG
    CD30L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59275-ACGLN
    CD30L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59275-ACR
    CD30L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59275-CF
    CD30L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59275-NF
    CD30L cDNA ORF Clone, Mouse, C-His tag MG59275-CH
    CD30L cDNA ORF Clone, Mouse, N-His tag MG59275-NH
    CD30L cDNA ORF Clone, Mouse, C-HA tag MG59275-CY
    CD30L cDNA ORF Clone, Mouse, N-HA tag MG59275-NY
    CD30L cDNA ORF Clone, Mouse, C-Myc tag MG59275-CM
    CD30L cDNA ORF Clone, Mouse, N-Myc tag MG59275-NM

    CD30L cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD30L cDNA ORF Clone in Cloning Vector, Human HG10040-M
    CD30L cDNA ORF Clone, Human, untagged HG10040-UT
    CD30L cDNA ORF Clone, Human, C-GFPSpark® tag HG10040-ACG
    CD30L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10040-ACGLN
    CD30L cDNA ORF Clone, Human, C-OFPSpark® tag HG10040-ACR
    CD30L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10040-CF
    CD30L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10040-NF
    CD30L cDNA ORF Clone, Human, C-His tag HG10040-CH
    CD30L cDNA ORF Clone, Human, N-His tag HG10040-NH
    CD30L cDNA ORF Clone, Human, C-HA tag HG10040-CY
    CD30L cDNA ORF Clone, Human, N-HA tag HG10040-NY
    CD30L cDNA ORF Clone, Human, C-Myc tag HG10040-CM
    CD30L cDNA ORF Clone, Human, N-Myc tag HG10040-NM
    CD30L qPCR Primer Pairs, Human HP100133
    info info
    添加购物车成功! 添加购物车失败!