After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus TNFSF14/LIGHT/CD258 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TNFSF14 cDNA Clone Product Information
NCBI RefSeq:HQ717157.1
RefSeq ORF Size:723bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) tumor necrosis factor (ligand) superfamily, member 14 with N terminal His tag.
Gene Synonym:TNFSF14
Species:Cynomolgus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

LIGHT, also known as TNFSF14 or CD258, is a newly identified member of the TNF superfamily (TNFSF14) that is expressed by activated T lymphocytes, monocytes, granulocytes, spleen cells, and immature dendritic cells. TNFSF14 / LIGHT / CD258 is a type II transmembrane protein that is known to bind 2 membrane-bound TNFSF signaling receptors: HVEM, which is predominantly expressed by T cells, and lymphotoxin β receptor (LTβR), which is expressed by stromal cells and nonlymphoid hematopoietic cells. TNFSF14 / LIGHT / CD258 also binds to a soluble nonsignaling receptor, decoy receptor 3 (DcR3), which can modulate the function of LIGHT in vivo. TNFSF14 / LIGHT / CD258 can also costimulate T cell responses via HVEM, which is constitutively expressed in most lymphocyte subpopulations, including CD4+ and CD8+ T cells. In addition, TNFSF14 / LIGHT / CD258 has been shown to suppress tumor formation in vivo and to induce tumor cell apoptosis via the up-regulation of intercellular adhesion molecule 1 and an increased lymphocyte adhesion to cancer cells. Thus, TNFSF14 / LIGHT / CD258 is being actively investigated as a possible basis for cancer treatment.

References
  • Ogawa T, et al. (2010) CXCR3 binding chemokine and TNFSF14 over expression in bladder urothelium of patients with ulcerative interstitial cystitis. J Urol. 183(3): 1206-12.
  • Kanodia S, et al. (2010) Expression of LIGHT/TNFSF14 combined with vaccination against human papillomavirus Type 16 E7 induces significant tumor regression. Cancer Res. 70(10): 3955-64.
  • Hosokawa Y, et al. (2010) TNFSF14 coordinately enhances CXCL10 and CXCL11 productions from IFN-gamma-stimulated human gingival fibroblasts. Mol Immunol. 47(4): 666-70.
  • Size / Price
    Catalog: CG90090-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"