Quick Order

Text Size:AAA

Cynomolgus TNFSF14/LIGHT/CD258 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TNFSF14 cDNA Clone Product Information
NCBI RefSeq:HQ717157.1
RefSeq ORF Size:723bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) tumor necrosis factor (ligand) superfamily, member 14 with C terminal Myc tag.
Gene Synonym:TNFSF14
Species:Cynomolgus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

LIGHT, also known as TNFSF14 or CD258, is a newly identified member of the TNF superfamily (TNFSF14) that is expressed by activated T lymphocytes, monocytes, granulocytes, spleen cells, and immature dendritic cells. TNFSF14 / LIGHT / CD258 is a type II transmembrane protein that is known to bind 2 membrane-bound TNFSF signaling receptors: HVEM, which is predominantly expressed by T cells, and lymphotoxin β receptor (LTβR), which is expressed by stromal cells and nonlymphoid hematopoietic cells. TNFSF14 / LIGHT / CD258 also binds to a soluble nonsignaling receptor, decoy receptor 3 (DcR3), which can modulate the function of LIGHT in vivo. TNFSF14 / LIGHT / CD258 can also costimulate T cell responses via HVEM, which is constitutively expressed in most lymphocyte subpopulations, including CD4+ and CD8+ T cells. In addition, TNFSF14 / LIGHT / CD258 has been shown to suppress tumor formation in vivo and to induce tumor cell apoptosis via the up-regulation of intercellular adhesion molecule 1 and an increased lymphocyte adhesion to cancer cells. Thus, TNFSF14 / LIGHT / CD258 is being actively investigated as a possible basis for cancer treatment.

References
  • Ogawa T, et al. (2010) CXCR3 binding chemokine and TNFSF14 over expression in bladder urothelium of patients with ulcerative interstitial cystitis. J Urol. 183(3): 1206-12.
  • Kanodia S, et al. (2010) Expression of LIGHT/TNFSF14 combined with vaccination against human papillomavirus Type 16 E7 induces significant tumor regression. Cancer Res. 70(10): 3955-64.
  • Hosokawa Y, et al. (2010) TNFSF14 coordinately enhances CXCL10 and CXCL11 productions from IFN-gamma-stimulated human gingival fibroblasts. Mol Immunol. 47(4): 666-70.
  • Size / Price
    Catalog: CG90090-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"