APRIL cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90095-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All APRIL Reagents
CRO Services
Product recommended

All APRIL Reagents
APRIL cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 13 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APRIL Background Information

TNFSF13 is a member of the tumor necrosis factor (TNF) ligand family. It is a ligand for TNFRSF17/BCMA. TNFSF13 is lowly expressed in normal tissues, but is elevated in several types of tumors and transformed cell lines. It is mportant for B cell development. TNFSF13 may also play a role in T-independent type II antigen responses and T cell survival, and induce proliferation/survival of non lymphoid cells. It exists as a functional homotrimer. It can bind to two cell surface receptors, BCMA and TACI, which it shares with BAFF to exert downstream T- and B-cell regulatory effects. TNFSF13 also has been demonstrated to bind to proteoglycans on the cell surface.

Full Name
tumor necrosis factor (ligand) superfamily, member 13
References
  • Bossen C, et al. (2007) BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18(5):263-75.
  • Tangye SG, et al. (2007) BAFF, APRIL and human B cell disorders. Immunol. 18(5): 305-17.
  • Osman W, et al. (2012) Association of common variants in TNFRSF13B, TNFSF13, and ANXA3 with serum levels of non-albumin protein and immunoglobulin isotypes in Japanese. PLoS One. 7(4):e32683.
  • APRIL cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    APRIL cDNA ORF Clone in Cloning Vector, Rhesus CG90095-G
    APRIL cDNA ORF Clone, Rhesus, untagged CG90095-UT
    APRIL Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90095-ACGLN
    APRIL cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90095-ACG
    APRIL cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90095-ACR
    APRIL cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90095-CF
    APRIL cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90095-NF
    APRIL cDNA ORF Clone, Rhesus, C-His tag CG90095-CH
    APRIL cDNA ORF Clone, Rhesus, N-His tag CG90095-NH
    APRIL cDNA ORF Clone, Rhesus, C-HA tag CG90095-CY
    APRIL cDNA ORF Clone, Rhesus, N-HA tag CG90095-NY
    APRIL cDNA ORF Clone, Rhesus, N-Myc tag CG90095-NM

    APRIL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    APRIL cDNA ORF Clone in Cloning Vector, Mouse MG50965-G
    APRIL cDNA ORF Clone, Mouse, untagged MG50965-UT
    APRIL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50965-ACG
    APRIL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50965-ACGLN
    APRIL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50965-ACR
    APRIL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50965-CF
    APRIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50965-NF
    APRIL cDNA ORF Clone, Mouse, C-His tag MG50965-CH
    APRIL cDNA ORF Clone, Mouse, N-His tag MG50965-NH
    APRIL cDNA ORF Clone, Mouse, C-HA tag MG50965-CY
    APRIL cDNA ORF Clone, Mouse, N-HA tag MG50965-NY
    APRIL cDNA ORF Clone, Mouse, C-Myc tag MG50965-CM
    APRIL cDNA ORF Clone, Mouse, N-Myc tag MG50965-NM
    APRIL qPCR Primer Pairs, Mouse MP200934

    APRIL cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    APRIL cDNA ORF Clone in Cloning Vector, Human HG10610-M
    APRIL cDNA ORF Clone, Human, untagged HG10610-UT
    APRIL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10610-ACGLN
    APRIL cDNA ORF Clone, Human, C-GFPSpark® tag HG10610-ACG
    APRIL cDNA ORF Clone, Human, C-OFPSpark® tag HG10610-ACR
    APRIL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10610-CF
    APRIL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10610-NF
    APRIL cDNA ORF Clone, Human, C-His tag HG10610-CH
    APRIL cDNA ORF Clone, Human, N-His tag HG10610-NH
    APRIL cDNA ORF Clone, Human, C-HA tag HG10610-CY
    APRIL cDNA ORF Clone, Human, N-HA tag HG10610-NY
    APRIL cDNA ORF Clone, Human, C-Myc tag HG10610-CM
    APRIL cDNA ORF Clone, Human, N-Myc tag HG10610-NM
    APRIL qPCR Primer Pairs, Human HP100596
    info info
    添加购物车成功! 添加购物车失败!