Quick Order

Rhesus TNFSF12 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TNFSF12 cDNA Clone Product Information
NCBI RefSeq:NM_001205135.1
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tumor necrosis factor (ligand) superfamily, member 12 with N terminal His tag.
Gene Synonym:TNFSF12
Species:Rhesus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TNFSF12 is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is a ligand for the FN14/TWEAKR receptor. TNFSF12 has overlapping signaling functions with TNF, but displays a much wider tissue distribution. It can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. It is also found that TNFSF12 promotes proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. TNFSF12 also is a weak inducer of apoptosis in some cell types and mediates NF-kappa-B activation.

References
  • Wiley SR, et al. (2004) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev. 14(3-4):241-9.
  • Campbell S, et al. (2006) The role of TWEAK/Fn14 in the pathogenesis of inflammation and systemic autoimmunity. Front Biosci. 9:2273-84.
  • Lynch CN, et al. (1999) TWEAK induces angiogenesis and proliferation of endothelial cells. J Biol Chem. 274(13):8455-9.
  • Size / Price
    Catalog: CG90094-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"