TRAIL cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90098-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRAIL Reagents
CRO Services
Product recommended

All TRAIL Reagents
TRAIL cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor (ligand) superfamily, member 10 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRAIL Background Information

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
tumor necrosis factor (ligand) superfamily, member 10
References
  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
  • TRAIL cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TRAIL cDNA ORF Clone in Cloning Vector, Rhesus CG90098-G
    TRAIL cDNA ORF Clone, Rhesus, untagged CG90098-UT
    TRAIL cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90098-ACG
    TRAIL Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90098-ACGLN
    TRAIL cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90098-ACR
    TRAIL cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90098-CF
    TRAIL cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90098-NF
    TRAIL cDNA ORF Clone, Rhesus, C-His tag CG90098-CH
    TRAIL cDNA ORF Clone, Rhesus, N-His tag CG90098-NH
    TRAIL cDNA ORF Clone, Rhesus, C-HA tag CG90098-CY
    TRAIL cDNA ORF Clone, Rhesus, N-HA tag CG90098-NY
    TRAIL cDNA ORF Clone, Rhesus, N-Myc tag CG90098-NM

    TRAIL cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    TRAIL cDNA ORF Clone in Cloning Vector, Canine DG70069-G
    TRAIL cDNA ORF Clone, Canine, untagged DG70069-UT
    TRAIL Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70069-ACGLN
    TRAIL cDNA ORF Clone, Canine, C-GFPSpark® tag DG70069-ACG
    TRAIL cDNA ORF Clone, Canine, C-OFPSpark® tag DG70069-ACR
    TRAIL cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70069-CF
    TRAIL cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70069-NF
    TRAIL cDNA ORF Clone, Canine, C-His tag DG70069-CH
    TRAIL cDNA ORF Clone, Canine, N-His tag DG70069-NH
    TRAIL cDNA ORF Clone, Canine, C-HA tag DG70069-CY
    TRAIL cDNA ORF Clone, Canine, N-HA tag DG70069-NY
    TRAIL cDNA ORF Clone, Canine, C-Myc tag DG70069-CM
    TRAIL cDNA ORF Clone, Canine, N-Myc tag DG70069-NM

    TRAIL cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TRAIL cDNA ORF Clone in Cloning Vector, Rat RG80152-G
    TRAIL cDNA ORF Clone, Rat, untagged RG80152-UT
    TRAIL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80152-ACG
    TRAIL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80152-ACGLN
    TRAIL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80152-ACR
    TRAIL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80152-CF
    TRAIL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80152-NF
    TRAIL cDNA ORF Clone, Rat, C-His tag RG80152-CH
    TRAIL cDNA ORF Clone, Rat, N-His tag RG80152-NH
    TRAIL cDNA ORF Clone, Rat, C-HA tag RG80152-CY
    TRAIL cDNA ORF Clone, Rat, N-HA tag RG80152-NY
    TRAIL cDNA ORF Clone, Rat, C-Myc tag RG80152-CM
    TRAIL cDNA ORF Clone, Rat, N-Myc tag RG80152-NM
    TRAIL qPCR Primer Pairs, Rat RP300147

    TRAIL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TRAIL cDNA ORF Clone in Cloning Vector, Mouse MG50166-M
    TRAIL cDNA ORF Clone, Mouse, untagged MG50166-UT
    TRAIL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50166-ACG
    TRAIL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50166-ACGLN
    TRAIL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50166-ANG
    TRAIL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50166-ACR
    TRAIL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50166-CF
    TRAIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50166-NF
    TRAIL cDNA ORF Clone, Mouse, C-His tag MG50166-CH
    TRAIL cDNA ORF Clone, Mouse, N-His tag MG50166-NH
    TRAIL cDNA ORF Clone, Mouse, C-HA tag MG50166-CY
    TRAIL cDNA ORF Clone, Mouse, N-HA tag MG50166-NY
    TRAIL cDNA ORF Clone, Mouse, C-Myc tag MG50166-CM
    TRAIL cDNA ORF Clone, Mouse, N-Myc tag MG50166-NM
    TRAIL qPCR Primer Pairs, Mouse MP200196

    TRAIL cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TRAIL cDNA ORF Clone in Cloning Vector, Human HG10409-M
    TRAIL cDNA ORF Clone, Human, untagged HG10409-UT
    TRAIL cDNA ORF Clone, Human, C-GFPSpark® tag HG10409-ACG
    TRAIL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10409-ACGLN
    TRAIL cDNA ORF Clone, Human, C-OFPSpark® tag HG10409-ACR
    TRAIL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10409-CF
    TRAIL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10409-NF
    TRAIL cDNA ORF Clone, Human, C-His tag HG10409-CH
    TRAIL cDNA ORF Clone, Human, N-His tag HG10409-NH
    TRAIL cDNA ORF Clone, Human, C-HA tag HG10409-CY
    TRAIL cDNA ORF Clone, Human, N-HA tag HG10409-NY
    TRAIL cDNA ORF Clone, Human, C-Myc tag HG10409-CM
    TRAIL cDNA ORF Clone, Human, N-Myc tag HG10409-NM
    TRAIL qPCR Primer Pairs, Human HP100439
    info info
    添加购物车成功! 添加购物车失败!