BCMA cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90103-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BCMA Reagents
CRO Services
Product recommended

All BCMA Reagents
BCMA cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
552 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 165 C/A not causing the amino acid variation. Please check the sequence information before order.
Description
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 17 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.6kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
BCMA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BCMA cDNA ORF Clone, Rhesus, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
BCMA Background Information

Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or CD269 antigen, is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13BBAFF), and to lead to NF-kappaB and MAPK8/JNK activation. TNFRSF17/BCMA/CD269 also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. TNFRSF17/BCMA/CD269 is a receptor for TALL-1 and BCMA activates NF-kappaB through a TRAF5-, TRAF6-, NIK-, and IKK-dependent pathway. The identification of TNFRSF17 as a NF-kappaB-activating receptor for TALL-1 suggests molecular targets for drug development against certain immunodeficient or autoimmune diseases. TNFRSF17/BCMA is a target of donor B-cell immunity in patients with myeloma who respond to DLI. Antibody responses to cell-surface BCMA may contribute directly to tumor rejection in vivo.

Full Name
tumor necrosis factor receptor superfamily member 17
References
  • Novak AJ, et al. (2004) Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood. 103 (2): 689–94.
  • O'Connor BP, et al. (2004) BCMA is essential for the survival of long-lived bone marrow plasma cells. J Exp Med. 199(1): 91-8.
  • Moser K, et al. (2006) Stromal niches, plasma cell differentiation and survival. Curr Opin Immunol. 18(3): 265-70.
  • BCMA cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BCMA cDNA ORF Clone in Cloning Vector, Rhesus CG90103-G
    BCMA cDNA ORF Clone, Rhesus, untagged CG90103-UT
    BCMA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90103-ACGLN
    BCMA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90103-ACG
    BCMA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90103-ACR
    BCMA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90103-CF
    BCMA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90103-NF
    BCMA cDNA ORF Clone, Rhesus, C-His tag CG90103-CH
    BCMA cDNA ORF Clone, Rhesus, N-His tag CG90103-NH
    BCMA cDNA ORF Clone, Rhesus, C-HA tag CG90103-CY
    BCMA cDNA ORF Clone, Rhesus, N-HA tag CG90103-NY
    BCMA cDNA ORF Clone, Rhesus, N-Myc tag CG90103-NM

    BCMA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BCMA cDNA ORF Clone in Cloning Vector, Rat RG80156-G
    BCMA cDNA ORF Clone, Rat, untagged RG80156-UT
    BCMA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80156-ACG
    BCMA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80156-ACGLN
    BCMA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80156-ACR
    BCMA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80156-CF
    BCMA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80156-NF
    BCMA cDNA ORF Clone, Rat, C-His tag RG80156-CH
    BCMA cDNA ORF Clone, Rat, N-His tag RG80156-NH
    BCMA cDNA ORF Clone, Rat, C-HA tag RG80156-CY
    BCMA cDNA ORF Clone, Rat, N-HA tag RG80156-NY
    BCMA cDNA ORF Clone, Rat, C-Myc tag RG80156-CM
    BCMA cDNA ORF Clone, Rat, N-Myc tag RG80156-NM
    BCMA qPCR Primer Pairs, Rat RP300151

    BCMA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BCMA cDNA ORF Clone in Cloning Vector, Human HG10620-M
    BCMA cDNA ORF Clone, Human, untagged HG10620-UT
    BCMA cDNA ORF Clone, Human, C-GFPSpark® tag HG10620-ACG
    BCMA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10620-ACGLN
    BCMA cDNA ORF Clone, Human, N-GFPSpark® tag HG10620-ANG
    BCMA cDNA ORF Clone, Human, C-OFPSpark® tag HG10620-ACR
    BCMA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10620-CF
    BCMA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10620-NF
    BCMA cDNA ORF Clone, Human, C-His tag HG10620-CH
    BCMA cDNA ORF Clone, Human, N-His tag HG10620-NH
    BCMA cDNA ORF Clone, Human, C-HA tag HG10620-CY
    BCMA cDNA ORF Clone, Human, N-HA tag HG10620-NY
    BCMA cDNA ORF Clone, Human, C-Myc tag HG10620-CM
    BCMA cDNA ORF Clone, Human, N-Myc tag HG10620-NM
    BCMA qPCR Primer Pairs, Human HP100601

    BCMA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BCMA qPCR Primer Pairs, Mouse MP200107
    info info
    添加购物车成功! 添加购物车失败!