Quick Order

Rhesus BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TNFRSF17 cDNA Clone Product Information
NCBI RefSeq:XM_001106892.2
RefSeq ORF Size:552bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tumor necrosis factor receptor superfamily, member 17 with N terminal Myc tag.
Gene Synonym:TNFRSF17
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or CD269 antigen, is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13BBAFF), and to lead to NF-kappaB and MAPK8/JNK activation. TNFRSF17/BCMA/CD269 also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. TNFRSF17/BCMA/CD269 is a receptor for TALL-1 and BCMA activates NF-kappaB through a TRAF5-, TRAF6-, NIK-, and IKK-dependent pathway. The identification of TNFRSF17 as a NF-kappaB-activating receptor for TALL-1 suggests molecular targets for drug development against certain immunodeficient or autoimmune diseases. TNFRSF17/BCMA is a target of donor B-cell immunity in patients with myeloma who respond to DLI. Antibody responses to cell-surface BCMA may contribute directly to tumor rejection in vivo.

References
  • Novak AJ, et al. (2004) Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood. 103 (2): 689–94.
  • O'Connor BP, et al. (2004) BCMA is essential for the survival of long-lived bone marrow plasma cells. J Exp Med. 199(1): 91-8.
  • Moser K, et al. (2006) Stromal niches, plasma cell differentiation and survival. Curr Opin Immunol. 18(3): 265-70.
  • Size / Price
    Catalog: CG90103-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"