DcR2 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90100-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DcR2 Reagents
CRO Services
Product recommended

All DcR2 Reagents
DcR2 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Rhesus tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DcR2 Background Information

Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL R4), CD264, and Decoy receptor 2, is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. TRAIL R4/CD264/TNFRSF10D is widely expressed, in particular in fetal kidney, lung and liver, and in adult testis and liver. TRAIL R4/CD264/TNFRSF10D is also expressed in peripheral blood leukocytes, colon and small intestine, ovary, prostate, thymus, spleen, pancreas, kidney, lung, placenta and heart. The signaling capacity of TRAIL R4 is similar to that of TRAIL R1 and TRAIL R2 with respect to NF-κB activation, but differs in its inability to induce apoptosis. TRAIL R4 retains a C-terminal element containing one third of a consensus death domain motif. Transient overexpression of TRAIL R4 in cells normally sensitive to TRAIL-mediated killing confers complete protection, suggesting that one function of TRAIL R4 may be inhibition of TRAIL cytotoxicity.

Full Name
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain
References
  • Degli-Esposti MA, et al. (1997) The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity. 7(6): 813-20.
  • Meng RD, et al. (2000) The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther. 1(2): 130-44.
  • Bouralexis S, et al. (2003) Progressive resistance of BTK-143 osteosarcoma cells to Apo2L/TRAIL-induced apoptosis is mediated by acquisition of DcR2/TRAIL-R4 expression: resensitisation with chemotherapy. Br J Cancer. 89(1): 206-14.
  • DcR2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    DcR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90100-G
    DcR2 cDNA ORF Clone, Rhesus, untagged CG90100-UT
    DcR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90100-ACG
    DcR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90100-ACGLN
    DcR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90100-ACR
    DcR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90100-CF
    DcR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90100-NF
    DcR2 cDNA ORF Clone, Rhesus, C-His tag CG90100-CH
    DcR2 cDNA ORF Clone, Rhesus, C-HA tag CG90100-CY
    DcR2 cDNA ORF Clone, Rhesus, N-HA tag CG90100-NY
    DcR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90100-CM
    DcR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90100-NM

    DcR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DcR2 cDNA ORF Clone in Cloning Vector, Human HG10413-M
    DcR2 cDNA ORF Clone, Human, untagged HG10413-UT
    DcR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10413-ACGLN
    DcR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10413-ACG
    DcR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10413-ACR
    DcR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10413-CF
    DcR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10413-NF
    DcR2 cDNA ORF Clone, Human, C-His tag HG10413-CH
    DcR2 cDNA ORF Clone, Human, N-His tag HG10413-NH
    DcR2 cDNA ORF Clone, Human, C-HA tag HG10413-CY
    DcR2 cDNA ORF Clone, Human, N-HA tag HG10413-NY
    DcR2 cDNA ORF Clone, Human, C-Myc tag HG10413-CM
    DcR2 cDNA ORF Clone, Human, N-Myc tag HG10413-NM
    DcR2 qPCR Primer Pairs, Human HP100443
    info info
    添加购物车成功! 添加购物车失败!