Quick Order

Rhesus TNFRSF10D / TRAILR4 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TNFRSF10D cDNA Clone Product Information
NCBI RefSeq:XM_001107922.1
RefSeq ORF Size:1149bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain with C terminal Myc tag.
Gene Synonym:TNFRSF10D
Species:Rhesus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member 10D (TNFRSF10D), also known as TNF-related apoptosis-inducing ligand receptor 4 (TRAIL R4), CD264, and Decoy receptor 2, is a member of the TNF-receptor superfamily. This receptor contains an extracellular TRAIL-binding domain, a transmembrane domain, and a truncated cytoplamic death domain. This receptor does not induce apoptosis, and has been shown to play an inhibitory role in TRAIL-induced cell apoptosis. TRAIL R4/CD264/TNFRSF10D is widely expressed, in particular in fetal kidney, lung and liver, and in adult testis and liver. TRAIL R4/CD264/TNFRSF10D is also expressed in peripheral blood leukocytes, colon and small intestine, ovary, prostate, thymus, spleen, pancreas, kidney, lung, placenta and heart. The signaling capacity of TRAIL R4 is similar to that of TRAIL R1 and TRAIL R2 with respect to NF-κB activation, but differs in its inability to induce apoptosis. TRAIL R4 retains a C-terminal element containing one third of a consensus death domain motif. Transient overexpression of TRAIL R4 in cells normally sensitive to TRAIL-mediated killing confers complete protection, suggesting that one function of TRAIL R4 may be inhibition of TRAIL cytotoxicity.

References
  • Degli-Esposti MA, et al. (1997) The novel receptor TRAIL-R4 induces NF-kappaB and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity. 7(6): 813-20.
  • Meng RD, et al. (2000) The TRAIL decoy receptor TRUNDD (DcR2, TRAIL-R4) is induced by adenovirus-p53 overexpression and can delay TRAIL-, p53-, and KILLER/DR5-dependent colon cancer apoptosis. Mol Ther. 1(2): 130-44.
  • Bouralexis S, et al. (2003) Progressive resistance of BTK-143 osteosarcoma cells to Apo2L/TRAIL-induced apoptosis is mediated by acquisition of DcR2/TRAIL-R4 expression: resensitisation with chemotherapy. Br J Cancer. 89(1): 206-14.
  • Size / Price
    Catalog: CG90100-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"