TMOD3 cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90459-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMOD3 Reagents
CRO Services
Product recommended

All TMOD3 Reagents
TMOD3 cDNA ORF Clone, Cynomolgus, C-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Description
Full length Clone DNA of Cynomolgus tropomodulin 3 (ubiquitous) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMOD3 Background Information
Full Name
tropomodulin 3 (ubiquitous)

TMOD3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TMOD3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90459-G
TMOD3 cDNA ORF Clone, Cynomolgus, untagged CG90459-UT
TMOD3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90459-ACG
TMOD3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90459-ACGLN
TMOD3 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90459-ANG
TMOD3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90459-ACR
TMOD3 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90459-ANR
TMOD3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90459-CF
TMOD3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90459-NF
TMOD3 cDNA ORF Clone, Cynomolgus, C-His tag CG90459-CH
TMOD3 cDNA ORF Clone, Cynomolgus, N-His tag CG90459-NH
TMOD3 cDNA ORF Clone, Cynomolgus, C-HA tag CG90459-CY
TMOD3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90459-NY
TMOD3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90459-NM

TMOD3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMOD3 cDNA ORF Clone in Cloning Vector, Rat RG8A1524-U
TMOD3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1524-ACGLN

TMOD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMOD3 cDNA ORF Clone in Cloning Vector, Mouse MG5A2304-U
TMOD3 cDNA ORF Clone, Mouse, untagged MG5A2304-UT
TMOD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2304-ACG
TMOD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2304-ACGLN
TMOD3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2304-ANG
TMOD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2304-ACR
TMOD3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2304-ANR
TMOD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2304-CF
TMOD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2304-NF
TMOD3 cDNA ORF Clone, Mouse, C-His tag MG5A2304-CH
TMOD3 cDNA ORF Clone, Mouse, N-His tag MG5A2304-NH
TMOD3 cDNA ORF Clone, Mouse, C-HA tag MG5A2304-CY
TMOD3 cDNA ORF Clone, Mouse, N-HA tag MG5A2304-NY
TMOD3 cDNA ORF Clone, Mouse, C-Myc tag MG5A2304-CM
TMOD3 cDNA ORF Clone, Mouse, N-Myc tag MG5A2304-NM

TMOD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMOD3 cDNA ORF Clone in Cloning Vector, Human HG15491-G
TMOD3 cDNA ORF Clone, Human, untagged HG15491-UT
TMOD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15491-ACGLN
TMOD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15491-ACG
TMOD3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15491-ANG
TMOD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15491-ACR
TMOD3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15491-ANR
TMOD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15491-CF
TMOD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15491-NF
TMOD3 cDNA ORF Clone, Human, C-His tag HG15491-CH
TMOD3 cDNA ORF Clone, Human, N-His tag HG15491-NH
TMOD3 cDNA ORF Clone, Human, C-HA tag HG15491-CY
TMOD3 cDNA ORF Clone, Human, N-HA tag HG15491-NY
TMOD3 cDNA ORF Clone, Human, C-Myc tag HG15491-CM
TMOD3 cDNA ORF Clone, Human, N-Myc tag HG15491-NM
TMOD3 qPCR Primer Pairs, Human HP104113
info info
添加购物车成功! 添加购物车失败!