TMEM50A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90375-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM50A Reagents
CRO Services
Product recommended

All TMEM50A Reagents
TMEM50A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
474 bp
Description
Full length Clone DNA of Rhesus transmembrane protein 50A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM50A Background Information
Full Name
transmembrane protein 50A

TMEM50A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TMEM50A cDNA ORF Clone in Cloning Vector, Rhesus CG90375-G
TMEM50A cDNA ORF Clone, Rhesus, untagged CG90375-UT
TMEM50A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90375-ACGLN
TMEM50A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90375-ACG
TMEM50A cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90375-ANG
TMEM50A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90375-ACR
TMEM50A cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90375-ANR
TMEM50A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90375-NF
TMEM50A cDNA ORF Clone, Rhesus, C-His tag CG90375-CH
TMEM50A cDNA ORF Clone, Rhesus, N-His tag CG90375-NH
TMEM50A cDNA ORF Clone, Rhesus, C-HA tag CG90375-CY
TMEM50A cDNA ORF Clone, Rhesus, N-HA tag CG90375-NY
TMEM50A cDNA ORF Clone, Rhesus, C-Myc tag CG90375-CM
TMEM50A cDNA ORF Clone, Rhesus, N-Myc tag CG90375-NM

TMEM50A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM50A cDNA ORF Clone in Cloning Vector, Mouse MG51568-U
TMEM50A cDNA ORF Clone, Mouse, untagged MG51568-UT
TMEM50A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51568-ACGLN
TMEM50A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51568-ACG
TMEM50A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51568-ANG
TMEM50A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51568-ACR
TMEM50A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51568-ANR
TMEM50A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51568-CF
TMEM50A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51568-NF
TMEM50A cDNA ORF Clone, Mouse, C-His tag MG51568-CH
TMEM50A cDNA ORF Clone, Mouse, N-His tag MG51568-NH
TMEM50A cDNA ORF Clone, Mouse, C-HA tag MG51568-CY
TMEM50A cDNA ORF Clone, Mouse, N-HA tag MG51568-NY
TMEM50A cDNA ORF Clone, Mouse, C-Myc tag MG51568-CM
TMEM50A cDNA ORF Clone, Mouse, N-Myc tag MG51568-NM
TMEM50A qPCR Primer Pairs, Mouse MP201451

TMEM50A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM50A cDNA ORF Clone in Cloning Vector, Human HG16681-U
TMEM50A cDNA ORF Clone, Human, untagged HG16681-UT
TMEM50A cDNA ORF Clone, Human, C-GFPSpark® tag HG16681-ACG
TMEM50A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16681-ACGLN
TMEM50A cDNA ORF Clone, Human, C-OFPSpark® tag HG16681-ACR
TMEM50A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16681-CF
TMEM50A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16681-NF
TMEM50A cDNA ORF Clone, Human, C-His tag HG16681-CH
TMEM50A cDNA ORF Clone, Human, N-His tag HG16681-NH
TMEM50A cDNA ORF Clone, Human, C-HA tag HG16681-CY
TMEM50A cDNA ORF Clone, Human, N-HA tag HG16681-NY
TMEM50A cDNA ORF Clone, Human, C-Myc tag HG16681-CM
TMEM50A cDNA ORF Clone, Human, N-Myc tag HG16681-NM
info info
添加购物车成功! 添加购物车失败!