Quick Order

Text Size:AAA

Rhesus TLR2 (CD282) Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus TLR2 cDNA Clone Product Information
NCBI RefSeq:NM_001130425.1
RefSeq ORF Size:2355bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) toll-like receptor 2 with C terminal Flag tag.
Gene Synonym:TLR2
Species:Rhesus
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

References
  • Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.
  • Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.
  • Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.
  • Size / Price
    Catalog: CG90254-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"