TBCC cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90542-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TBCC Reagents
CRO Services
Product recommended

All TBCC Reagents
TBCC cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Cynomolgus tubulin folding cofactor C with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TBCC Background Information
Full Name
tubulin folding cofactor C

TBCC cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TBCC cDNA ORF Clone in Cloning Vector, Cynomolgus CG90542-G
TBCC cDNA ORF Clone, Cynomolgus, untagged CG90542-UT
TBCC cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90542-ACG
TBCC Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90542-ACGLN
TBCC cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90542-ANG
TBCC cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90542-ACR
TBCC cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90542-ANR
TBCC cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90542-CF
TBCC cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90542-NF
TBCC cDNA ORF Clone, Cynomolgus, C-His tag CG90542-CH
TBCC cDNA ORF Clone, Cynomolgus, N-His tag CG90542-NH
TBCC cDNA ORF Clone, Cynomolgus, N-HA tag CG90542-NY
TBCC cDNA ORF Clone, Cynomolgus, C-Myc tag CG90542-CM
TBCC cDNA ORF Clone, Cynomolgus, N-Myc tag CG90542-NM

TBCC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TBCC cDNA ORF Clone in Cloning Vector, Human HG15488-G
TBCC cDNA ORF Clone, Human, untagged HG15488-UT
TBCC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15488-ACGLN
TBCC cDNA ORF Clone, Human, C-GFPSpark® tag HG15488-ACG
TBCC cDNA ORF Clone, Human, N-GFPSpark® tag HG15488-ANG
TBCC cDNA ORF Clone, Human, C-OFPSpark® tag HG15488-ACR
TBCC cDNA ORF Clone, Human, N-OFPSpark® tag HG15488-ANR
TBCC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15488-CF
TBCC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15488-NF
TBCC cDNA ORF Clone, Human, C-His tag HG15488-CH
TBCC cDNA ORF Clone, Human, N-His tag HG15488-NH
TBCC cDNA ORF Clone, Human, C-HA tag HG15488-CY
TBCC cDNA ORF Clone, Human, N-HA tag HG15488-NY
TBCC cDNA ORF Clone, Human, C-Myc tag HG15488-CM
TBCC cDNA ORF Clone, Human, N-Myc tag HG15488-NM
TBCC qPCR Primer Pairs, Human HP104110
info info
添加购物车成功! 添加购物车失败!