SNRPN cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90771-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SNRPN Reagents
CRO Services
Product recommended

All SNRPN Reagents
SNRPN cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Rhesus small nuclear ribonucleoprotein polypeptide N with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNRPN Background Information
Full Name
small nuclear ribonucleoprotein polypeptide N

SNRPN cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SNRPN cDNA ORF Clone in Cloning Vector, Canine DG70192-U
SNRPN cDNA ORF Clone, Canine, untagged DG70192-UT
SNRPN cDNA ORF Clone, Canine, C-GFPSpark® tag DG70192-ACG
SNRPN Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70192-ACGLN
SNRPN cDNA ORF Clone, Canine, N-GFPSpark® tag DG70192-ANG
SNRPN cDNA ORF Clone, Canine, C-OFPSpark® tag DG70192-ACR
SNRPN cDNA ORF Clone, Canine, N-OFPSpark® tag DG70192-ANR
SNRPN cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70192-CF
SNRPN cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70192-NF
SNRPN cDNA ORF Clone, Canine, C-His tag DG70192-CH
SNRPN cDNA ORF Clone, Canine, N-His tag DG70192-NH
SNRPN cDNA ORF Clone, Canine, C-HA tag DG70192-CY
SNRPN cDNA ORF Clone, Canine, N-HA tag DG70192-NY
SNRPN cDNA ORF Clone, Canine, C-Myc tag DG70192-CM
SNRPN cDNA ORF Clone, Canine, N-Myc tag DG70192-NM

SNRPN cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SNRPN cDNA ORF Clone in Cloning Vector, Rhesus CG90771-G
SNRPN cDNA ORF Clone, Rhesus, untagged CG90771-UT
SNRPN Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90771-ACGLN
SNRPN cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90771-ACG
SNRPN cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90771-ANG
SNRPN cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90771-ACR
SNRPN cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90771-ANR
SNRPN cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90771-CF
SNRPN cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90771-NF
SNRPN cDNA ORF Clone, Rhesus, C-His tag CG90771-CH
SNRPN cDNA ORF Clone, Rhesus, N-His tag CG90771-NH
SNRPN cDNA ORF Clone, Rhesus, C-HA tag CG90771-CY
SNRPN cDNA ORF Clone, Rhesus, N-HA tag CG90771-NY
SNRPN cDNA ORF Clone, Rhesus, C-Myc tag CG90771-CM

SNRPN cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
SNRPN cDNA ORF Clone in Cloning Vector, Rabbit TG65126-G
SNRPN cDNA ORF Clone, Rabbit, untagged TG65126-UT
SNRPN cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65126-ACG
SNRPN Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65126-ACGLN
SNRPN cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65126-ANG
SNRPN cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65126-ACR
SNRPN cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65126-ANR
SNRPN cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65126-CF
SNRPN cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65126-NF
SNRPN cDNA ORF Clone, Rabbit, C-His tag TG65126-CH
SNRPN cDNA ORF Clone, Rabbit, N-His tag TG65126-NH
SNRPN cDNA ORF Clone, Rabbit, C-HA tag TG65126-CY
SNRPN cDNA ORF Clone, Rabbit, N-HA tag TG65126-NY
SNRPN cDNA ORF Clone, Rabbit, C-Myc tag TG65126-CM
SNRPN cDNA ORF Clone, Rabbit, N-Myc tag TG65126-NM

SNRPN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNRPN cDNA ORF Clone in Cloning Vector, Human HG16721-U
SNRPN cDNA ORF Clone, Human, untagged HG16721-UT
SNRPN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16721-ACGLN
SNRPN cDNA ORF Clone, Human, C-GFPSpark® tag HG16721-ACG
SNRPN cDNA ORF Clone, Human, N-GFPSpark® tag HG16721-ANG
SNRPN cDNA ORF Clone, Human, C-OFPSpark® tag HG16721-ACR
SNRPN cDNA ORF Clone, Human, N-OFPSpark® tag HG16721-ANR
SNRPN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16721-CF
SNRPN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16721-NF
SNRPN cDNA ORF Clone, Human, C-His tag HG16721-CH
SNRPN cDNA ORF Clone, Human, N-His tag HG16721-NH
SNRPN cDNA ORF Clone, Human, C-HA tag HG16721-CY
SNRPN cDNA ORF Clone, Human, N-HA tag HG16721-NY
SNRPN cDNA ORF Clone, Human, C-Myc tag HG16721-CM
SNRPN cDNA ORF Clone, Human, N-Myc tag HG16721-NM
info info
添加购物车成功! 添加购物车失败!