SLC25A5 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90815-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SLC25A5 Reagents

CRO Services

Product recommended


All SLC25A5 Reagents

SLC25A5 cDNA ORF Clone, Rhesus, N-Myc tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rhesus solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A5 Background Information

Full Name
solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5

SLC25A5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rhesus CG90815-G
SLC25A5 cDNA ORF Clone, Rhesus, untagged CG90815-UT
SLC25A5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90815-ACGLN
SLC25A5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90815-ACG
SLC25A5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90815-ANG
SLC25A5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90815-ACR
SLC25A5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90815-ANR
SLC25A5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90815-CF
SLC25A5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90815-NF
SLC25A5 cDNA ORF Clone, Rhesus, C-His tag CG90815-CH
SLC25A5 cDNA ORF Clone, Rhesus, N-His tag CG90815-NH
SLC25A5 cDNA ORF Clone, Rhesus, C-HA tag CG90815-CY
SLC25A5 cDNA ORF Clone, Rhesus, N-HA tag CG90815-NY
SLC25A5 cDNA ORF Clone, Rhesus, C-Myc tag CG90815-CM

SLC25A5 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rabbit TG65133-G
SLC25A5 cDNA ORF Clone, Rabbit, untagged TG65133-UT
SLC25A5 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65133-ACG
SLC25A5 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65133-ANG
SLC25A5 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65133-ACR
SLC25A5 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65133-ANR
SLC25A5 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65133-CF
SLC25A5 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65133-NF
SLC25A5 cDNA ORF Clone, Rabbit, C-His tag TG65133-CH
SLC25A5 cDNA ORF Clone, Rabbit, N-His tag TG65133-NH
SLC25A5 cDNA ORF Clone, Rabbit, C-HA tag TG65133-CY
SLC25A5 cDNA ORF Clone, Rabbit, N-HA tag TG65133-NY
SLC25A5 cDNA ORF Clone, Rabbit, C-Myc tag TG65133-CM
SLC25A5 cDNA ORF Clone, Rabbit, N-Myc tag TG65133-NM

SLC25A5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Rat RG81484-G

SLC25A5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Mouse MG51406-G
SLC25A5 cDNA ORF Clone, Mouse, untagged MG51406-UT
SLC25A5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51406-ACGLN
SLC25A5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51406-ACG
SLC25A5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51406-ANG
SLC25A5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51406-ACR
SLC25A5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51406-ANR
SLC25A5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51406-CF
SLC25A5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51406-NF
SLC25A5 cDNA ORF Clone, Mouse, C-His tag MG51406-CH
SLC25A5 cDNA ORF Clone, Mouse, N-His tag MG51406-NH
SLC25A5 cDNA ORF Clone, Mouse, C-HA tag MG51406-CY
SLC25A5 cDNA ORF Clone, Mouse, N-HA tag MG51406-NY
SLC25A5 cDNA ORF Clone, Mouse, C-Myc tag MG51406-CM
SLC25A5 cDNA ORF Clone, Mouse, N-Myc tag MG51406-NM
SLC25A5 qPCR Primer Pairs, Mouse MP201290

SLC25A5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A5 cDNA ORF Clone in Cloning Vector, Human HG16208-G
SLC25A5 cDNA ORF Clone, Human, untagged HG16208-UT
SLC25A5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16208-ACGLN
SLC25A5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16208-ACG
SLC25A5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16208-ANG
SLC25A5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16208-ACR
SLC25A5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16208-ANR
SLC25A5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16208-CF
SLC25A5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16208-NF
SLC25A5 cDNA ORF Clone, Human, C-His tag HG16208-CH
SLC25A5 cDNA ORF Clone, Human, N-His tag HG16208-NH
SLC25A5 cDNA ORF Clone, Human, C-HA tag HG16208-CY
SLC25A5 cDNA ORF Clone, Human, N-HA tag HG16208-NY
SLC25A5 cDNA ORF Clone, Human, C-Myc tag HG16208-CM
SLC25A5 cDNA ORF Clone, Human, N-Myc tag HG16208-NM
SLC25A5 qPCR Primer Pairs, Human HP104974
info info
添加购物车成功! 添加购物车失败!