SLC25A33 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90684-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SLC25A33 Reagents
CRO Services

All SLC25A33 Reagents
SLC25A33 cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
966 bp
Description
Full length Clone DNA of Cynomolgus solute carrier family 25 (pyrimidine nucleotide carrier), member 33 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SLC25A33 Background Information
Full Name
solute carrier family 25 (pyrimidine nucleotide carrier), member 33

SLC25A33 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SLC25A33 cDNA ORF Clone in Cloning Vector, Mouse MG51829-G
SLC25A33 cDNA ORF Clone, Mouse, untagged MG51829-UT
SLC25A33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51829-ACG
SLC25A33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51829-ACGLN
SLC25A33 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51829-ANG
SLC25A33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51829-ACR
SLC25A33 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51829-ANR
SLC25A33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51829-CF
SLC25A33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51829-NF
SLC25A33 cDNA ORF Clone, Mouse, C-His tag MG51829-CH
SLC25A33 cDNA ORF Clone, Mouse, N-His tag MG51829-NH
SLC25A33 cDNA ORF Clone, Mouse, C-HA tag MG51829-CY
SLC25A33 cDNA ORF Clone, Mouse, N-HA tag MG51829-NY
SLC25A33 cDNA ORF Clone, Mouse, C-Myc tag MG51829-CM
SLC25A33 cDNA ORF Clone, Mouse, N-Myc tag MG51829-NM
SLC25A33 qPCR Primer Pairs, Mouse MP201702

SLC25A33 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SLC25A33 cDNA ORF Clone in Cloning Vector, Human HG22698-U
SLC25A33 cDNA ORF Clone, Human, untagged HG22698-UT
SLC25A33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22698-ACGLN
SLC25A33 cDNA ORF Clone, Human, C-GFPSpark® tag HG22698-ACG
SLC25A33 cDNA ORF Clone, Human, N-GFPSpark® tag HG22698-ANG
SLC25A33 cDNA ORF Clone, Human, C-OFPSpark® tag HG22698-ACR
SLC25A33 cDNA ORF Clone, Human, N-OFPSpark® tag HG22698-ANR
SLC25A33 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22698-CF
SLC25A33 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22698-NF
SLC25A33 cDNA ORF Clone, Human, C-His tag HG22698-CH
SLC25A33 cDNA ORF Clone, Human, N-His tag HG22698-NH
SLC25A33 cDNA ORF Clone, Human, C-HA tag HG22698-CY
SLC25A33 cDNA ORF Clone, Human, N-HA tag HG22698-NY
SLC25A33 cDNA ORF Clone, Human, C-Myc tag HG22698-CM
SLC25A33 cDNA ORF Clone, Human, N-Myc tag HG22698-NM
info info
添加购物车成功! 添加购物车失败!