Quick Order

Text Size:AAA

Cynomolgus SH3TC1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus SH3TC1 cDNA Clone Product Information
    NCBI RefSeq:AB046629.2
    RefSeq ORF Size:447bp
    cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) SH3 domain and tetratricopeptide repeats 1 with C terminal His tag.
    Gene Synonym:SH3TC1
    Species:Cynomolgus
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Size / Price
    Catalog: CG90830-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"