SH3GLB2 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90678-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SH3GLB2 Reagents
CRO Services
Product recommended

All SH3GLB2 Reagents
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1215 bp
Description
Full length Clone DNA of Cynomolgus SH3-domain GRB2-like endophilin B2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SH3GLB2 Background Information
Full Name
SH3-domain GRB2-like endophilin B2

SH3GLB2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SH3GLB2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90678-G
SH3GLB2 cDNA ORF Clone, Cynomolgus, untagged CG90678-UT
SH3GLB2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90678-ACGLN
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90678-ACG
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90678-ANG
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90678-ACR
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90678-ANR
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90678-CF
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90678-NF
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-His tag CG90678-CH
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90678-CY
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90678-NY
SH3GLB2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90678-CM
SH3GLB2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90678-NM

SH3GLB2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SH3GLB2 cDNA ORF Clone in Cloning Vector, Mouse MG5A4347-U
SH3GLB2 cDNA ORF Clone, Mouse, untagged MG5A4347-UT
SH3GLB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4347-ACGLN
SH3GLB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4347-ACG
SH3GLB2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4347-ANG
SH3GLB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4347-ACR
SH3GLB2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4347-ANR
SH3GLB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4347-CF
SH3GLB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4347-NF
SH3GLB2 cDNA ORF Clone, Mouse, C-His tag MG5A4347-CH
SH3GLB2 cDNA ORF Clone, Mouse, N-His tag MG5A4347-NH
SH3GLB2 cDNA ORF Clone, Mouse, C-HA tag MG5A4347-CY
SH3GLB2 cDNA ORF Clone, Mouse, N-HA tag MG5A4347-NY
SH3GLB2 cDNA ORF Clone, Mouse, C-Myc tag MG5A4347-CM
SH3GLB2 cDNA ORF Clone, Mouse, N-Myc tag MG5A4347-NM

SH3GLB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SH3GLB2 cDNA ORF Clone, Human, untagged HG21170-UT
info info
添加购物车成功! 添加购物车失败!