SEMA7A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90218-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SEMA7A Reagents
CRO Services
Product recommended

All SEMA7A Reagents
SEMA7A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1995 bp
Description
Full length Clone DNA of Rhesus semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEMA7A Background Information
Full Name
semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)

SEMA7A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SEMA7A cDNA ORF Clone in Cloning Vector, Rhesus CG90218-G
SEMA7A cDNA ORF Clone, Rhesus, untagged CG90218-UT
SEMA7A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90218-ACGLN
SEMA7A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90218-ACG
SEMA7A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90218-ACR
SEMA7A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90218-NF
SEMA7A cDNA ORF Clone, Rhesus, C-His tag CG90218-CH
SEMA7A cDNA ORF Clone, Rhesus, N-His tag CG90218-NH
SEMA7A cDNA ORF Clone, Rhesus, C-HA tag CG90218-CY
SEMA7A cDNA ORF Clone, Rhesus, N-HA tag CG90218-NY
SEMA7A cDNA ORF Clone, Rhesus, C-Myc tag CG90218-CM
SEMA7A cDNA ORF Clone, Rhesus, N-Myc tag CG90218-NM

SEMA7A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SEMA7A cDNA ORF Clone in Cloning Vector, Rat RG80345-G
SEMA7A cDNA ORF Clone, Rat, untagged RG80345-UT
SEMA7A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80345-ACGLN
SEMA7A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80345-ACG
SEMA7A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80345-ACR
SEMA7A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80345-CF
SEMA7A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80345-NF
SEMA7A cDNA ORF Clone, Rat, C-His tag RG80345-CH
SEMA7A cDNA ORF Clone, Rat, N-His tag RG80345-NH
SEMA7A cDNA ORF Clone, Rat, C-HA tag RG80345-CY
SEMA7A cDNA ORF Clone, Rat, N-HA tag RG80345-NY
SEMA7A cDNA ORF Clone, Rat, C-Myc tag RG80345-CM
SEMA7A cDNA ORF Clone, Rat, N-Myc tag RG80345-NM
SEMA7A qPCR Primer Pairs, Rat RP300315

SEMA7A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEMA7A cDNA ORF Clone, Human, untagged HG19224-UT
info info
添加购物车成功! 添加购物车失败!