Secretogranin 3 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90789-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Secretogranin 3 Reagents
CRO Services
Product recommended

All Secretogranin 3 Reagents
Secretogranin 3 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Rhesus secretogranin III with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Secretogranin 3 Background Information

SCG3, also known as secretogranin 3, is a member of the chromogranin/secretogranin family. Members of this family may serve as precursors for biologically active peptides. SCG3 is transported to secretory granules (SGs) in neuroendocrine cells. SCG3 binds strongly to chromogranin A (CgA) in an intragranular milieu and targets CgA to SGs in pituitary and pancreatic endocrine cells. With a sucrose density gradient of rat insulinoma-derived INS-1 cell homogenates, SgIII is localized to the SG fraction and is fractionated to the SG membrane (SGM) despite lacking the transmembrane region.

Full Name
secretogranin III
References
>
  • Rong YP. et al., 2002, Sheng Wu Wu Li Xue Bao. 34 (4): 411-7.
  • Huttner WB. et al., 1991, Trends Biochem Sci. 16 (1): 27-30.
  • Ozawa H. et al., 1996, Cell Struct Funct. 20 (6): 415-20.
  • Secretogranin 3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Secretogranin 3 cDNA ORF Clone in Cloning Vector, Rhesus CG90789-G
    Secretogranin 3 cDNA ORF Clone, Rhesus, untagged CG90789-UT
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90789-ACG
    Secretogranin 3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90789-ACGLN
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90789-ACR
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90789-CF
    Secretogranin 3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90789-NF
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-His tag CG90789-CH
    Secretogranin 3 cDNA ORF Clone, Rhesus, N-His tag CG90789-NH
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-HA tag CG90789-CY
    Secretogranin 3 cDNA ORF Clone, Rhesus, N-HA tag CG90789-NY
    Secretogranin 3 cDNA ORF Clone, Rhesus, C-Myc tag CG90789-CM

    Secretogranin 3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Secretogranin 3 cDNA ORF Clone in Cloning Vector, Mouse MG51561-G
    Secretogranin 3 cDNA ORF Clone, Mouse, untagged MG51561-UT
    Secretogranin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51561-ACG
    Secretogranin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51561-ACGLN
    Secretogranin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51561-ACR
    Secretogranin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51561-CF
    Secretogranin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51561-NF
    Secretogranin 3 cDNA ORF Clone, Mouse, C-His tag MG51561-CH
    Secretogranin 3 cDNA ORF Clone, Mouse, N-His tag MG51561-NH
    Secretogranin 3 cDNA ORF Clone, Mouse, C-HA tag MG51561-CY
    Secretogranin 3 cDNA ORF Clone, Mouse, N-HA tag MG51561-NY
    Secretogranin 3 cDNA ORF Clone, Mouse, C-Myc tag MG51561-CM
    Secretogranin 3 cDNA ORF Clone, Mouse, N-Myc tag MG51561-NM
    Secretogranin 3 qPCR Primer Pairs, Mouse MP201444
    info info
    添加购物车成功! 添加购物车失败!