RRAGA cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90435-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RRAGA Reagents
CRO Services
Product recommended

All RRAGA Reagents
RRAGA cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Rhesus Ras-related GTP binding A with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRAGA Background Information
Full Name
Ras-related GTP binding A

RRAGA cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RRAGA cDNA ORF Clone in Cloning Vector, Rhesus CG90435-G
RRAGA cDNA ORF Clone, Rhesus, untagged CG90435-UT
RRAGA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90435-ACG
RRAGA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90435-ACGLN
RRAGA cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90435-ANG
RRAGA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90435-ACR
RRAGA cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90435-ANR
RRAGA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90435-CF
RRAGA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90435-NF
RRAGA cDNA ORF Clone, Rhesus, N-His tag CG90435-NH
RRAGA cDNA ORF Clone, Rhesus, C-HA tag CG90435-CY
RRAGA cDNA ORF Clone, Rhesus, N-HA tag CG90435-NY
RRAGA cDNA ORF Clone, Rhesus, C-Myc tag CG90435-CM
RRAGA cDNA ORF Clone, Rhesus, N-Myc tag CG90435-NM

RRAGA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RRAGA cDNA ORF Clone in Cloning Vector, Rat RG87014-U
RRAGA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87014-ACGLN

RRAGA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RRAGA cDNA ORF Clone in Cloning Vector, Mouse MG51468-G
RRAGA cDNA ORF Clone, Mouse, untagged MG51468-UT
RRAGA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51468-ACG
RRAGA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51468-ACGLN
RRAGA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51468-ANG
RRAGA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51468-ACR
RRAGA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51468-ANR
RRAGA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51468-CF
RRAGA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51468-NF
RRAGA cDNA ORF Clone, Mouse, C-His tag MG51468-CH
RRAGA cDNA ORF Clone, Mouse, N-His tag MG51468-NH
RRAGA cDNA ORF Clone, Mouse, C-HA tag MG51468-CY
RRAGA cDNA ORF Clone, Mouse, N-HA tag MG51468-NY
RRAGA cDNA ORF Clone, Mouse, C-Myc tag MG51468-CM
RRAGA cDNA ORF Clone, Mouse, N-Myc tag MG51468-NM
RRAGA qPCR Primer Pairs, Mouse MP201352

RRAGA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RRAGA cDNA ORF Clone in Cloning Vector, Human HG14715-G
RRAGA cDNA ORF Clone, Human, untagged HG14715-UT
RRAGA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14715-ACGLN
RRAGA cDNA ORF Clone, Human, C-GFPSpark® tag HG14715-ACG
RRAGA cDNA ORF Clone, Human, N-GFPSpark® tag HG14715-ANG
RRAGA cDNA ORF Clone, Human, C-OFPSpark® tag HG14715-ACR
RRAGA cDNA ORF Clone, Human, N-OFPSpark® tag HG14715-ANR
RRAGA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14715-CF
RRAGA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14715-NF
RRAGA cDNA ORF Clone, Human, C-His tag HG14715-CH
RRAGA cDNA ORF Clone, Human, N-His tag HG14715-NH
RRAGA cDNA ORF Clone, Human, C-HA tag HG14715-CY
RRAGA cDNA ORF Clone, Human, N-HA tag HG14715-NY
RRAGA cDNA ORF Clone, Human, C-Myc tag HG14715-CM
RRAGA cDNA ORF Clone, Human, N-Myc tag HG14715-NM
RRAGA qPCR Primer Pairs, Human HP103349
info info
添加购物车成功! 添加购物车失败!