RPSA cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90639-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPSA Reagents
CRO Services
Product recommended

All RPSA Reagents
RPSA cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
888 bp
Description
Full length Clone DNA of Rhesus ribosomal protein SA with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPSA Background Information
Full Name
ribosomal protein SA

RPSA cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RPSA cDNA ORF Clone in Cloning Vector, Rhesus CG90639-G
RPSA cDNA ORF Clone, Rhesus, untagged CG90639-UT
RPSA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90639-ACGLN
RPSA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90639-ACG
RPSA cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90639-ANG
RPSA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90639-ACR
RPSA cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90639-ANR
RPSA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90639-CF
RPSA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90639-NF
RPSA cDNA ORF Clone, Rhesus, C-His tag CG90639-CH
RPSA cDNA ORF Clone, Rhesus, C-HA tag CG90639-CY
RPSA cDNA ORF Clone, Rhesus, N-HA tag CG90639-NY
RPSA cDNA ORF Clone, Rhesus, C-Myc tag CG90639-CM
RPSA cDNA ORF Clone, Rhesus, N-Myc tag CG90639-NM

RPSA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPSA cDNA ORF Clone in Cloning Vector, Rat RG80795-U
RPSA cDNA ORF Clone, Rat, untagged RG80795-UT
RPSA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80795-ACG
RPSA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80795-ACGLN
RPSA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80795-ACR
RPSA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80795-CF
RPSA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80795-NF
RPSA cDNA ORF Clone, Rat, C-His tag RG80795-CH
RPSA cDNA ORF Clone, Rat, N-His tag RG80795-NH
RPSA cDNA ORF Clone, Rat, C-HA tag RG80795-CY
RPSA cDNA ORF Clone, Rat, N-HA tag RG80795-NY
RPSA cDNA ORF Clone, Rat, C-Myc tag RG80795-CM
RPSA cDNA ORF Clone, Rat, N-Myc tag RG80795-NM
RPSA qPCR Primer Pairs, Rat RP300759

RPSA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPSA cDNA ORF Clone in Cloning Vector, Mouse MG51911-G
RPSA cDNA ORF Clone, Mouse, untagged MG51911-UT
RPSA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51911-ACG
RPSA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51911-ACGLN
RPSA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51911-ANG
RPSA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51911-ACR
RPSA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51911-ANR
RPSA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51911-CF
RPSA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51911-NF
RPSA cDNA ORF Clone, Mouse, C-His tag MG51911-CH
RPSA cDNA ORF Clone, Mouse, N-His tag MG51911-NH
RPSA cDNA ORF Clone, Mouse, C-HA tag MG51911-CY
RPSA cDNA ORF Clone, Mouse, N-HA tag MG51911-NY
RPSA cDNA ORF Clone, Mouse, C-Myc tag MG51911-CM
RPSA cDNA ORF Clone, Mouse, N-Myc tag MG51911-NM
RPSA qPCR Primer Pairs, Mouse MP201784

RPSA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPSA cDNA ORF Clone in Cloning Vector, Human HG16384-G
RPSA cDNA ORF Clone, Human, untagged HG16384-UT
RPSA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16384-ACGLN
RPSA cDNA ORF Clone, Human, C-GFPSpark® tag HG16384-ACG
RPSA cDNA ORF Clone, Human, C-OFPSpark® tag HG16384-ACR
RPSA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16384-CF
RPSA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16384-NF
RPSA cDNA ORF Clone, Human, C-His tag HG16384-CH
RPSA cDNA ORF Clone, Human, N-His tag HG16384-NH
RPSA cDNA ORF Clone, Human, C-HA tag HG16384-CY
RPSA cDNA ORF Clone, Human, N-HA tag HG16384-NY
RPSA cDNA ORF Clone, Human, C-Myc tag HG16384-CM
RPSA cDNA ORF Clone, Human, N-Myc tag HG16384-NM
RPSA qPCR Primer Pairs, Human HP105133
info info
添加购物车成功! 添加购物车失败!