RPS7 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90554-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS7 Reagents
CRO Services
Product recommended

All RPS7 Reagents
RPS7 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Rhesus ribosomal protein S7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS7 Background Information
Full Name
ribosomal protein S7

RPS7 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RPS7 cDNA ORF Clone in Cloning Vector, Rhesus CG90554-U
RPS7 cDNA ORF Clone, Rhesus, untagged CG90554-UT
RPS7 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90554-ACGLN
RPS7 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90554-ACG
RPS7 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90554-ANG
RPS7 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90554-ACR
RPS7 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90554-ANR
RPS7 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90554-CF
RPS7 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90554-NF
RPS7 cDNA ORF Clone, Rhesus, C-His tag CG90554-CH
RPS7 cDNA ORF Clone, Rhesus, N-His tag CG90554-NH
RPS7 cDNA ORF Clone, Rhesus, C-HA tag CG90554-CY
RPS7 cDNA ORF Clone, Rhesus, N-HA tag CG90554-NY
RPS7 cDNA ORF Clone, Rhesus, N-Myc tag CG90554-NM

RPS7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS7 cDNA ORF Clone in Cloning Vector, Rat RG84296-U
RPS7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84296-ACGLN

RPS7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS7 cDNA ORF Clone in Cloning Vector, Mouse MG51515-G
RPS7 cDNA ORF Clone, Mouse, untagged MG51515-UT
RPS7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51515-ACG
RPS7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51515-ACGLN
RPS7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51515-ANG
RPS7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51515-ACR
RPS7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51515-ANR
RPS7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51515-CF
RPS7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51515-NF
RPS7 cDNA ORF Clone, Mouse, C-His tag MG51515-CH
RPS7 cDNA ORF Clone, Mouse, N-His tag MG51515-NH
RPS7 cDNA ORF Clone, Mouse, C-HA tag MG51515-CY
RPS7 cDNA ORF Clone, Mouse, N-HA tag MG51515-NY
RPS7 cDNA ORF Clone, Mouse, C-Myc tag MG51515-CM
RPS7 cDNA ORF Clone, Mouse, N-Myc tag MG51515-NM
RPS7 qPCR Primer Pairs, Mouse MP201399

RPS7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS7 cDNA ORF Clone in Cloning Vector, Human HG17206-U
RPS7 cDNA ORF Clone, Human, untagged HG17206-UT
RPS7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17206-ACGLN
RPS7 cDNA ORF Clone, Human, C-GFPSpark® tag HG17206-ACG
RPS7 cDNA ORF Clone, Human, N-GFPSpark® tag HG17206-ANG
RPS7 cDNA ORF Clone, Human, C-OFPSpark® tag HG17206-ACR
RPS7 cDNA ORF Clone, Human, N-OFPSpark® tag HG17206-ANR
RPS7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17206-CF
RPS7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17206-NF
RPS7 cDNA ORF Clone, Human, C-His tag HG17206-CH
RPS7 cDNA ORF Clone, Human, N-His tag HG17206-NH
RPS7 cDNA ORF Clone, Human, C-HA tag HG17206-CY
RPS7 cDNA ORF Clone, Human, N-HA tag HG17206-NY
RPS7 cDNA ORF Clone, Human, C-Myc tag HG17206-CM
RPS7 cDNA ORF Clone, Human, N-Myc tag HG17206-NM
info info
添加购物车成功! 添加购物车失败!