RPL27 cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90382-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL27 Reagents
CRO Services
Product recommended

All RPL27 Reagents
RPL27 cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
411 bp
Description
Full length Clone DNA of Rhesus ribosomal protein L27 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL27 Background Information
Full Name
ribosomal protein L27

RPL27 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RPL27 cDNA ORF Clone in Cloning Vector, Rhesus CG90382-G
RPL27 cDNA ORF Clone, Rhesus, untagged CG90382-UT
RPL27 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90382-ACG
RPL27 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90382-ACGLN
RPL27 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90382-ANG
RPL27 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90382-ACR
RPL27 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90382-ANR
RPL27 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90382-CF
RPL27 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90382-NF
RPL27 cDNA ORF Clone, Rhesus, N-His tag CG90382-NH
RPL27 cDNA ORF Clone, Rhesus, C-HA tag CG90382-CY
RPL27 cDNA ORF Clone, Rhesus, N-HA tag CG90382-NY
RPL27 cDNA ORF Clone, Rhesus, C-Myc tag CG90382-CM
RPL27 cDNA ORF Clone, Rhesus, N-Myc tag CG90382-NM

RPL27 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL27 cDNA ORF Clone in Cloning Vector, Human HG16987-U
RPL27 cDNA ORF Clone, Human, untagged HG16987-UT
RPL27 cDNA ORF Clone, Human, C-GFPSpark® tag HG16987-ACG
RPL27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16987-ACGLN
RPL27 cDNA ORF Clone, Human, N-GFPSpark® tag HG16987-ANG
RPL27 cDNA ORF Clone, Human, C-OFPSpark® tag HG16987-ACR
RPL27 cDNA ORF Clone, Human, N-OFPSpark® tag HG16987-ANR
RPL27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16987-CF
RPL27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16987-NF
RPL27 cDNA ORF Clone, Human, C-His tag HG16987-CH
RPL27 cDNA ORF Clone, Human, N-His tag HG16987-NH
RPL27 cDNA ORF Clone, Human, C-HA tag HG16987-CY
RPL27 cDNA ORF Clone, Human, N-HA tag HG16987-NY
RPL27 cDNA ORF Clone, Human, C-Myc tag HG16987-CM
RPL27 cDNA ORF Clone, Human, N-Myc tag HG16987-NM
info info
添加购物车成功! 添加购物车失败!