Quick Order

Text Size:AAA

Cynomolgus RHBDD2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus RHBDD2 cDNA Clone Product Information
NCBI RefSeq:XM_005549339
RefSeq ORF Size:1095bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) rhomboid domain containing 2.
Gene Synonym:RHBDD2
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: CG90794-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"