RDH12 cDNA ORF Clone, Rhesus, untagged

Cat: CG90796-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RDH12 Reagents
CRO Services
Product recommended

All RDH12 Reagents
RDH12 cDNA ORF Clone, Rhesus, untagged General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Rhesus retinol dehydrogenase 12 (all-trans/9-cis/11-cis).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RDH12 Background Information
Full Name
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)

RDH12 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RDH12 cDNA ORF Clone in Cloning Vector, Rhesus CG90796-G
RDH12 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90796-ACGLN
RDH12 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90796-ACG
RDH12 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90796-ACR
RDH12 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90796-CF
RDH12 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90796-NF
RDH12 cDNA ORF Clone, Rhesus, C-His tag CG90796-CH
RDH12 cDNA ORF Clone, Rhesus, N-His tag CG90796-NH
RDH12 cDNA ORF Clone, Rhesus, C-HA tag CG90796-CY
RDH12 cDNA ORF Clone, Rhesus, N-HA tag CG90796-NY
RDH12 cDNA ORF Clone, Rhesus, C-Myc tag CG90796-CM
RDH12 cDNA ORF Clone, Rhesus, N-Myc tag CG90796-NM

RDH12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RDH12 cDNA ORF Clone in Cloning Vector, Human HG14101-G
RDH12 cDNA ORF Clone, Human, untagged HG14101-UT
RDH12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14101-ACGLN
RDH12 cDNA ORF Clone, Human, C-GFPSpark® tag HG14101-ACG
RDH12 cDNA ORF Clone, Human, N-GFPSpark® tag HG14101-ANG
RDH12 cDNA ORF Clone, Human, C-OFPSpark® tag HG14101-ACR
RDH12 cDNA ORF Clone, Human, N-OFPSpark® tag HG14101-ANR
RDH12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14101-CF
RDH12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14101-NF
RDH12 cDNA ORF Clone, Human, C-His tag HG14101-CH
RDH12 cDNA ORF Clone, Human, N-His tag HG14101-NH
RDH12 cDNA ORF Clone, Human, C-HA tag HG14101-CY
RDH12 cDNA ORF Clone, Human, N-HA tag HG14101-NY
RDH12 cDNA ORF Clone, Human, C-Myc tag HG14101-CM
RDH12 cDNA ORF Clone, Human, N-Myc tag HG14101-NM
RDH12 qPCR Primer Pairs, Human HP102754
info info
添加购物车成功! 添加购物车失败!