RDH11 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90467-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RDH11 Reagents
CRO Services
Product recommended

All RDH11 Reagents
RDH11 cDNA ORF Clone, Rhesus, C-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Rhesus retinol dehydrogenase 11 (all-trans/9-cis/11-cis) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RDH11 Background Information
Full Name
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)

RDH11 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RDH11 cDNA ORF Clone in Cloning Vector, Rhesus CG90467-G
RDH11 cDNA ORF Clone, Rhesus, untagged CG90467-UT
RDH11 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90467-ACG
RDH11 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90467-ACGLN
RDH11 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90467-ANG
RDH11 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90467-ACR
RDH11 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90467-ANR
RDH11 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90467-CF
RDH11 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90467-NF
RDH11 cDNA ORF Clone, Rhesus, C-His tag CG90467-CH
RDH11 cDNA ORF Clone, Rhesus, N-His tag CG90467-NH
RDH11 cDNA ORF Clone, Rhesus, N-HA tag CG90467-NY
RDH11 cDNA ORF Clone, Rhesus, C-Myc tag CG90467-CM
RDH11 cDNA ORF Clone, Rhesus, N-Myc tag CG90467-NM

RDH11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RDH11 cDNA ORF Clone in Cloning Vector, Mouse MG53115-G
RDH11 cDNA ORF Clone, Mouse, untagged MG53115-UT
RDH11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53115-ACGLN
RDH11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53115-ACG
RDH11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53115-ACR
RDH11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53115-CF
RDH11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53115-NF
RDH11 cDNA ORF Clone, Mouse, C-His tag MG53115-CH
RDH11 cDNA ORF Clone, Mouse, N-His tag MG53115-NH
RDH11 cDNA ORF Clone, Mouse, C-HA tag MG53115-CY
RDH11 cDNA ORF Clone, Mouse, N-HA tag MG53115-NY
RDH11 cDNA ORF Clone, Mouse, C-Myc tag MG53115-CM
RDH11 cDNA ORF Clone, Mouse, N-Myc tag MG53115-NM

RDH11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RDH11 cDNA ORF Clone in Cloning Vector, Human HG14102-G
RDH11 cDNA ORF Clone, Human, untagged HG14102-UT
RDH11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14102-ACGLN
RDH11 cDNA ORF Clone, Human, C-GFPSpark® tag HG14102-ACG
RDH11 cDNA ORF Clone, Human, N-GFPSpark® tag HG14102-ANG
RDH11 cDNA ORF Clone, Human, C-OFPSpark® tag HG14102-ACR
RDH11 cDNA ORF Clone, Human, N-OFPSpark® tag HG14102-ANR
RDH11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14102-CF
RDH11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14102-NF
RDH11 cDNA ORF Clone, Human, C-His tag HG14102-CH
RDH11 cDNA ORF Clone, Human, N-His tag HG14102-NH
RDH11 cDNA ORF Clone, Human, C-HA tag HG14102-CY
RDH11 cDNA ORF Clone, Human, N-HA tag HG14102-NY
RDH11 cDNA ORF Clone, Human, C-Myc tag HG14102-CM
RDH11 cDNA ORF Clone, Human, N-Myc tag HG14102-NM
RDH11 qPCR Primer Pairs, Human HP102755
info info
添加购物车成功! 添加购物车失败!