RbAp48 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90743-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RbAp48 Reagents
CRO Services
Product recommended

All RbAp48 Reagents
RbAp48 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Rhesus retinoblastoma binding protein 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RbAp48 Background Information

Histone-binding protein RBBP4, also known as Retinoblastoma-binding protein 4, Retinoblastoma-binding protein p48, Chromatin assembly factor 1 subunit C, Chromatin assembly factor I p48 subunit, Nucleosome-remodeling factor subunit RBAP48 and RBBP4, is a nucleus protein which belongs to the WD repeat RBAP46/RBAP48/MSI1 family. RBBP4 is a core histone-binding subunit that may target chromatin assembly factors, chromatin remodeling factors and histone deacetylases to their histone substrates in a manner that is regulated by nucleosomal DNA. RBBP4 is a component of several complexes which regulate chromatin metabolism. These include the chromatin assembly factor 1 (CAF-1) complex, which is required for chromatin assembly following DNA replication and DNA repair; the core histone deacetylase (HDAC) complex, which promotes histone deacetylation and consequent transcriptional repression; the nucleosome remodeling and histone deacetylase complex (the NuRD complex), which promotes transcriptional repression by histone deacetylation and nucleosome remodeling and the NURF (nucleosome remodeling factor) complex.

One common myth is that age-related memory loss is an early indication of Alzheimer's disease. But researchers at the Columbia University Medical Center in New York City have found a specific protein, RbAp48, that they believe is responsible for age-related memory problems. What's more, by replenishing RbAp48 in the brains of mice, the researchers were able to undo existing age-related memory damage.

To find RbAp48, researchers focused on the hippocampus, the region of the brain where memories are formed. After studying eight healthy brains donated to science by people between the ages of 33 and 88, they found that RbAp48 was reduced by nearly 50 percent in the older brains. The researchers found that when they turned off RbAp48 in younger mice, they became more forgetful, while increasing RbAp48 in older mice restored memory. The mice were given memory tests that included object recognition and water maze problems.

Full Name
retinoblastoma binding protein 4
References
  • Rasmussen HH. et al.,1992, Electrophoresis 13:960-9.
  • Qian Y.-W. et al., 1993,  Nature 364:648-52.
  • Yarden R.I. et al., 1999, Proc. Natl. Acad. Sci. USA. 96: 4983-8.
  • Ota T. et al., 2004, Nat. Genet. 36:40-45.
  • Gauci S. et al., 2009, Anal. Chem. 81:4493-501.
  • RbAp48 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    RbAp48 cDNA ORF Clone in Cloning Vector, Rhesus CG90743-G
    RbAp48 cDNA ORF Clone, Rhesus, untagged CG90743-UT
    RbAp48 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90743-ACG
    RbAp48 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90743-ACGLN
    RbAp48 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90743-ANG
    RbAp48 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90743-ACR
    RbAp48 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90743-ANR
    RbAp48 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90743-CF
    RbAp48 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90743-NF
    RbAp48 cDNA ORF Clone, Rhesus, C-His tag CG90743-CH
    RbAp48 cDNA ORF Clone, Rhesus, N-His tag CG90743-NH
    RbAp48 cDNA ORF Clone, Rhesus, C-HA tag CG90743-CY
    RbAp48 cDNA ORF Clone, Rhesus, N-HA tag CG90743-NY
    RbAp48 cDNA ORF Clone, Rhesus, C-Myc tag CG90743-CM

    RbAp48 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RbAp48 cDNA ORF Clone in Cloning Vector, Rat RG8A1167-U
    RbAp48 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1167-ACGLN

    RbAp48 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RbAp48 cDNA ORF Clone in Cloning Vector, Mouse MG51526-G
    RbAp48 cDNA ORF Clone, Mouse, untagged MG51526-UT
    RbAp48 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51526-ACGLN
    RbAp48 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51526-ACG
    RbAp48 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51526-ANG
    RbAp48 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51526-ACR
    RbAp48 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51526-ANR
    RbAp48 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51526-CF
    RbAp48 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51526-NF
    RbAp48 cDNA ORF Clone, Mouse, C-His tag MG51526-CH
    RbAp48 cDNA ORF Clone, Mouse, N-His tag MG51526-NH
    RbAp48 cDNA ORF Clone, Mouse, C-HA tag MG51526-CY
    RbAp48 cDNA ORF Clone, Mouse, N-HA tag MG51526-NY
    RbAp48 cDNA ORF Clone, Mouse, C-Myc tag MG51526-CM
    RbAp48 cDNA ORF Clone, Mouse, N-Myc tag MG51526-NM
    RbAp48 qPCR Primer Pairs, Mouse MP201410

    RbAp48 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RbAp48 cDNA ORF Clone in Cloning Vector, Human HG11309-M
    RbAp48 cDNA ORF Clone, Human, untagged HG11309-UT
    RbAp48 cDNA ORF Clone, Human, C-GFPSpark® tag HG11309-ACG
    RbAp48 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11309-ACGLN
    RbAp48 cDNA ORF Clone, Human, N-GFPSpark® tag HG11309-ANG
    RbAp48 cDNA ORF Clone, Human, C-OFPSpark® tag HG11309-ACR
    RbAp48 cDNA ORF Clone, Human, N-OFPSpark® tag HG11309-ANR
    RbAp48 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11309-CF
    RbAp48 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11309-NF
    RbAp48 cDNA ORF Clone, Human, C-His tag HG11309-CH
    RbAp48 cDNA ORF Clone, Human, N-His tag HG11309-NH
    RbAp48 cDNA ORF Clone, Human, C-HA tag HG11309-CY
    RbAp48 cDNA ORF Clone, Human, N-HA tag HG11309-NY
    RbAp48 cDNA ORF Clone, Human, C-Myc tag HG11309-CM
    RbAp48 cDNA ORF Clone, Human, N-Myc tag HG11309-NM
    RbAp48 qPCR Primer Pairs, Human HP101197
    info info
    添加购物车成功! 添加购物车失败!