RAB1A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90518-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB1A Reagents
CRO Services
Product recommended

All RAB1A Reagents
RAB1A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Cynomolgus RAB1A, member RAS oncogene family with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB1A Background Information
Full Name
RAB1A, member RAS oncogene family

RAB1A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RAB1A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90518-G
RAB1A cDNA ORF Clone, Cynomolgus, untagged CG90518-UT
RAB1A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90518-ACGLN
RAB1A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90518-ACG
RAB1A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90518-ANG
RAB1A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90518-ACR
RAB1A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90518-ANR
RAB1A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90518-CF
RAB1A cDNA ORF Clone, Cynomolgus, C-His tag CG90518-CH
RAB1A cDNA ORF Clone, Cynomolgus, N-His tag CG90518-NH
RAB1A cDNA ORF Clone, Cynomolgus, C-HA tag CG90518-CY
RAB1A cDNA ORF Clone, Cynomolgus, N-HA tag CG90518-NY
RAB1A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90518-CM
RAB1A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90518-NM

RAB1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB1A cDNA ORF Clone in Cloning Vector, Rat RG81648-G
RAB1A cDNA ORF Clone, Rat, untagged RG81648-UT
RAB1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81648-ACGLN
RAB1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81648-ACG
RAB1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81648-ACR
RAB1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81648-CF
RAB1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81648-NF
RAB1A cDNA ORF Clone, Rat, C-His tag RG81648-CH
RAB1A cDNA ORF Clone, Rat, N-His tag RG81648-NH
RAB1A cDNA ORF Clone, Rat, C-HA tag RG81648-CY
RAB1A cDNA ORF Clone, Rat, N-HA tag RG81648-NY
RAB1A cDNA ORF Clone, Rat, C-Myc tag RG81648-CM
RAB1A cDNA ORF Clone, Rat, N-Myc tag RG81648-NM

RAB1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB1A cDNA ORF Clone in Cloning Vector, Human HG16400-G
RAB1A cDNA ORF Clone, Human, untagged HG16400-UT
RAB1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16400-ACG
RAB1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16400-ACGLN
RAB1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16400-ACR
RAB1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16400-CF
RAB1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16400-NF
RAB1A cDNA ORF Clone, Human, C-His tag HG16400-CH
RAB1A cDNA ORF Clone, Human, N-His tag HG16400-NH
RAB1A cDNA ORF Clone, Human, C-HA tag HG16400-CY
RAB1A cDNA ORF Clone, Human, N-HA tag HG16400-NY
RAB1A cDNA ORF Clone, Human, C-Myc tag HG16400-CM
RAB1A cDNA ORF Clone, Human, N-Myc tag HG16400-NM
RAB1A qPCR Primer Pairs, Human HP105149
info info
添加购物车成功! 添加购物车失败!