Prostaglandin D Synthase cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90694-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Prostaglandin D Synthase Reagents
CRO Services
Product recommended

All Prostaglandin D Synthase Reagents
Prostaglandin D Synthase cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Rhesus prostaglandin D2 synthase 21kDa (brain) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prostaglandin D Synthase Background Information

PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.

Full Name
prostaglandin D2 synthase 21kDa (brain)
References
  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • Prostaglandin D Synthase cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Prostaglandin D Synthase cDNA ORF Clone in Cloning Vector, Rhesus CG90694-G
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, untagged CG90694-UT
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90694-ACG
    Prostaglandin D Synthase Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90694-ACGLN
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90694-ACR
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90694-CF
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90694-NF
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-His tag CG90694-CH
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-HA tag CG90694-CY
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, N-HA tag CG90694-NY
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, C-Myc tag CG90694-CM
    Prostaglandin D Synthase cDNA ORF Clone, Rhesus, N-Myc tag CG90694-NM

    Prostaglandin D Synthase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Prostaglandin D Synthase cDNA ORF Clone in Cloning Vector, Rat RG81340-G
    Prostaglandin D Synthase cDNA ORF Clone, Rat, untagged RG81340-UT
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81340-ACG
    Prostaglandin D Synthase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81340-ACGLN
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81340-ACR
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81340-CF
    Prostaglandin D Synthase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81340-NF
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-His tag RG81340-CH
    Prostaglandin D Synthase cDNA ORF Clone, Rat, N-His tag RG81340-NH
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-HA tag RG81340-CY
    Prostaglandin D Synthase cDNA ORF Clone, Rat, N-HA tag RG81340-NY
    Prostaglandin D Synthase cDNA ORF Clone, Rat, C-Myc tag RG81340-CM
    Prostaglandin D Synthase cDNA ORF Clone, Rat, N-Myc tag RG81340-NM
    Prostaglandin D Synthase qPCR Primer Pairs, Rat RP301286

    Prostaglandin D Synthase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Prostaglandin D Synthase cDNA ORF Clone in Cloning Vector, Mouse MG51472-G
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, untagged MG51472-UT
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51472-ACG
    Prostaglandin D Synthase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51472-ACGLN
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51472-ACR
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51472-CF
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51472-NF
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-His tag MG51472-CH
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, N-His tag MG51472-NH
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-HA tag MG51472-CY
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, N-HA tag MG51472-NY
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, C-Myc tag MG51472-CM
    Prostaglandin D Synthase cDNA ORF Clone, Mouse, N-Myc tag MG51472-NM
    Prostaglandin D Synthase qPCR Primer Pairs, Mouse MP201356

    Prostaglandin D Synthase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Prostaglandin D Synthase cDNA ORF Clone in Cloning Vector, Human HG13346-G
    Prostaglandin D Synthase cDNA ORF Clone, Human, untagged HG13346-UT
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-GFPSpark® tag HG13346-ACG
    Prostaglandin D Synthase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13346-ACGLN
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-OFPSpark® tag HG13346-ACR
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13346-CF
    Prostaglandin D Synthase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13346-NF
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-His tag HG13346-CH
    Prostaglandin D Synthase cDNA ORF Clone, Human, N-His tag HG13346-NH
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-HA tag HG13346-CY
    Prostaglandin D Synthase cDNA ORF Clone, Human, N-HA tag HG13346-NY
    Prostaglandin D Synthase cDNA ORF Clone, Human, C-Myc tag HG13346-CM
    Prostaglandin D Synthase cDNA ORF Clone, Human, N-Myc tag HG13346-NM
    Prostaglandin D Synthase qPCR Primer Pairs, Human HP102051
    info info
    添加购物车成功! 添加购物车失败!