PSMB6 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90402-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMB6 Reagents
CRO Services
Product recommended

All PSMB6 Reagents
PSMB6 cDNA ORF Clone, Rhesus, C-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
720 bp
Description
Full length Clone DNA of Rhesus proteasome (prosome, macropain) subunit, beta type, 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB6 Background Information
Full Name
proteasome (prosome, macropain) subunit, beta type, 6

PSMB6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PSMB6 cDNA ORF Clone in Cloning Vector, Rhesus CG90402-G
PSMB6 cDNA ORF Clone, Rhesus, untagged CG90402-UT
PSMB6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90402-ACG
PSMB6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90402-ACGLN
PSMB6 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90402-ANG
PSMB6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90402-ACR
PSMB6 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90402-ANR
PSMB6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90402-CF
PSMB6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90402-NF
PSMB6 cDNA ORF Clone, Rhesus, C-His tag CG90402-CH
PSMB6 cDNA ORF Clone, Rhesus, N-His tag CG90402-NH
PSMB6 cDNA ORF Clone, Rhesus, N-HA tag CG90402-NY
PSMB6 cDNA ORF Clone, Rhesus, C-Myc tag CG90402-CM
PSMB6 cDNA ORF Clone, Rhesus, N-Myc tag CG90402-NM

PSMB6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB6 cDNA ORF Clone in Cloning Vector, Mouse MG51239-U
PSMB6 cDNA ORF Clone, Mouse, untagged MG51239-UT
PSMB6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51239-ACG
PSMB6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51239-ACGLN
PSMB6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51239-ANG
PSMB6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51239-ACR
PSMB6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51239-ANR
PSMB6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51239-CF
PSMB6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51239-NF
PSMB6 cDNA ORF Clone, Mouse, C-His tag MG51239-CH
PSMB6 cDNA ORF Clone, Mouse, N-His tag MG51239-NH
PSMB6 cDNA ORF Clone, Mouse, C-HA tag MG51239-CY
PSMB6 cDNA ORF Clone, Mouse, N-HA tag MG51239-NY
PSMB6 cDNA ORF Clone, Mouse, C-Myc tag MG51239-CM
PSMB6 cDNA ORF Clone, Mouse, N-Myc tag MG51239-NM
PSMB6 qPCR Primer Pairs, Mouse MP201122

PSMB6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB6 cDNA ORF Clone in Cloning Vector, Human HG17201-U
PSMB6 cDNA ORF Clone, Human, untagged HG17201-UT
PSMB6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17201-ACGLN
PSMB6 cDNA ORF Clone, Human, C-GFPSpark® tag HG17201-ACG
PSMB6 cDNA ORF Clone, Human, N-GFPSpark® tag HG17201-ANG
PSMB6 cDNA ORF Clone, Human, C-OFPSpark® tag HG17201-ACR
PSMB6 cDNA ORF Clone, Human, N-OFPSpark® tag HG17201-ANR
PSMB6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17201-CF
PSMB6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17201-NF
PSMB6 cDNA ORF Clone, Human, C-His tag HG17201-CH
PSMB6 cDNA ORF Clone, Human, N-His tag HG17201-NH
PSMB6 cDNA ORF Clone, Human, C-HA tag HG17201-CY
PSMB6 cDNA ORF Clone, Human, N-HA tag HG17201-NY
PSMB6 cDNA ORF Clone, Human, C-Myc tag HG17201-CM
PSMB6 cDNA ORF Clone, Human, N-Myc tag HG17201-NM
info info
添加购物车成功! 添加购物车失败!