Quick Order

Rhesus Trypsin 2/PRSS2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus PRSS2 cDNA Clone Product Information
NCBI RefSeq:NM_001047120.1
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) protease, serine, 2 (trypsin 2) with C terminal HA tag.
Gene Synonym:PRSS2
Species:Rhesus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

References
  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    Catalog: CG90525-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"