PPP4C cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90650-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PPP4C Reagents
CRO Services
Product recommended

All PPP4C Reagents
PPP4C cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Cynomolgus protein phosphatase 4, catalytic subunit with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP4C Background Information
Full Name
protein phosphatase 4, catalytic subunit

PPP4C cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
PPP4C cDNA ORF Clone in Cloning Vector, Cynomolgus CG90650-G
PPP4C cDNA ORF Clone, Cynomolgus, untagged CG90650-UT
PPP4C Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90650-ACGLN
PPP4C cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90650-ACG
PPP4C cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90650-ANG
PPP4C cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90650-ACR
PPP4C cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90650-ANR
PPP4C cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90650-CF
PPP4C cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90650-NF
PPP4C cDNA ORF Clone, Cynomolgus, C-His tag CG90650-CH
PPP4C cDNA ORF Clone, Cynomolgus, C-HA tag CG90650-CY
PPP4C cDNA ORF Clone, Cynomolgus, N-HA tag CG90650-NY
PPP4C cDNA ORF Clone, Cynomolgus, C-Myc tag CG90650-CM
PPP4C cDNA ORF Clone, Cynomolgus, N-Myc tag CG90650-NM

PPP4C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PPP4C cDNA ORF Clone in Cloning Vector, Mouse MG53917-U
PPP4C cDNA ORF Clone, Mouse, untagged MG53917-UT
PPP4C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53917-ACG
PPP4C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53917-ACGLN
PPP4C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53917-ANG
PPP4C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53917-ACR
PPP4C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53917-ANR
PPP4C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53917-CF
PPP4C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53917-NF
PPP4C cDNA ORF Clone, Mouse, C-His tag MG53917-CH
PPP4C cDNA ORF Clone, Mouse, N-His tag MG53917-NH
PPP4C cDNA ORF Clone, Mouse, C-HA tag MG53917-CY
PPP4C cDNA ORF Clone, Mouse, N-HA tag MG53917-NY
PPP4C cDNA ORF Clone, Mouse, C-Myc tag MG53917-CM
PPP4C cDNA ORF Clone, Mouse, N-Myc tag MG53917-NM

PPP4C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP4C cDNA ORF Clone in Cloning Vector, Human HG16999-U
PPP4C cDNA ORF Clone, Human, untagged HG16999-UT
PPP4C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16999-ACGLN
PPP4C cDNA ORF Clone, Human, C-GFPSpark® tag HG16999-ACG
PPP4C cDNA ORF Clone, Human, N-GFPSpark® tag HG16999-ANG
PPP4C cDNA ORF Clone, Human, C-OFPSpark® tag HG16999-ACR
PPP4C cDNA ORF Clone, Human, N-OFPSpark® tag HG16999-ANR
PPP4C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16999-CF
PPP4C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16999-NF
PPP4C cDNA ORF Clone, Human, C-His tag HG16999-CH
PPP4C cDNA ORF Clone, Human, N-His tag HG16999-NH
PPP4C cDNA ORF Clone, Human, C-HA tag HG16999-CY
PPP4C cDNA ORF Clone, Human, N-HA tag HG16999-NY
PPP4C cDNA ORF Clone, Human, C-Myc tag HG16999-CM
PPP4C cDNA ORF Clone, Human, N-Myc tag HG16999-NM
info info
添加购物车成功! 添加购物车失败!