Quick Order

Rhesus PPP2R2D natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus PPP2R2D cDNA Clone Product Information
NCBI RefSeq:XM_001091312.2
RefSeq ORF Size:867bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform-like.
Gene Synonym:PPP2R2D
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: CG90762-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"